Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32831
Trapped Gene
Itpr3 (ENSMUSG00000042644)
Vector Insertion
Chr 17: 27253243 - 27253553
Public Clones IST14042A12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000248011 (Chr17:27253117..27253242 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGCCGCTCATCTACTGGTT Chr17:27253119..27253138 59.72 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000248011 (Chr17:27253117..27253242 +)
Downstram Exon
ENSMUSE00000247991 (Chr17:27253554..27253726 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGCCGCTCATCTACTGGTT Chr17:27253119..27253138 59.72 50 TGTAGCGCTTGGTGAACAGT Chr17:27253640..27253659 59.51 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000610379 Chr17:27194481..27194619 TTCTTCACATCGGGGACATT Chr17:27194550..27194569 60.32 45
upstream ENSMUSE00000610378 Chr17:27210043..27210113 No primer for this exon
upstream ENSMUSE00000610377 Chr17:27220475..27220596 CATGAACCGCTACTCTGCAC Chr17:27220497..27220516 59.47 55
upstream ENSMUSE00000610376 Chr17:27222034..27222120 CAGATGGAGCAGAAGCAAAA Chr17:27222043..27222062 59.15 45
upstream ENSMUSE00000610375 Chr17:27223784..27223942 CTCTTCATCCAGCCCTTCTG Chr17:27223898..27223917 59.94 55
upstream ENSMUSE00000610374 Chr17:27224091..27224189 GTGATAATGCTGGCTGCAAA Chr17:27224167..27224186 59.84 45
upstream ENSMUSE00000610373 Chr17:27224536..27224619 CAACACCAGCTGGAAGATCA Chr17:27224553..27224572 59.83 50
upstream ENSMUSE00000610372 Chr17:27225897..27226043 ATGAGTACAGGGGCAAGCTG Chr17:27225949..27225968 60.28 55
upstream ENSMUSE00000610371 Chr17:27226207..27226302 TGGAACGGTCTGTACAGGTTC Chr17:27226246..27226266 60.02 52.38
upstream ENSMUSE00000610370 Chr17:27226561..27226611 CCCAGCTACAAGGGTGATGT Chr17:27226567..27226586 59.99 55
upstream ENSMUSE00000610369 Chr17:27226775..27226917 GGCGAGAAGATCAAGTACCG Chr17:27226808..27226827 59.84 55
upstream ENSMUSE00000610368 Chr17:27228256..27228355 CTCTGCACCAACACCTGGAT Chr17:27228281..27228300 61.13 55
upstream ENSMUSE00000610367 Chr17:27228438..27228598 GAAGGCTTCATCAGCCAGAA Chr17:27228570..27228589 60.48 50
upstream ENSMUSE00000610366 Chr17:27228759..27228900 ATGCGGGAGCAGAACATACT Chr17:27228874..27228893 59.72 50
upstream ENSMUSE00000610365 Chr17:27230120..27230281 CTCAGGAGGACTACCGCAAG Chr17:27230256..27230275 60.01 60
upstream ENSMUSE00000610364 Chr17:27231740..27231912 AGACGGAGGTGGAGACCTTT Chr17:27231861..27231880 60.11 55
upstream ENSMUSE00000610363 Chr17:27232409..27232528 TGGACTACCTCTCCGACCTG Chr17:27232414..27232433 60.25 60
upstream ENSMUSE00000610362 Chr17:27232832..27233014 TCACGAGTACCTCAGCATCG Chr17:27232862..27232881 60.01 55
upstream ENSMUSE00000610361 Chr17:27234907..27235158 ACGGCCATCACCATTAAAGA Chr17:27235139..27235158 60.33 45
upstream ENSMUSE00000610360 Chr17:27235259..27235403 GCCAACGACGAGAAGAACAT Chr17:27235371..27235390 60.26 50
upstream ENSMUSE00000610359 Chr17:27235919..27236060 CTGGCGCACAATCTCATCTA Chr17:27235928..27235947 59.97 50
upstream ENSMUSE00000610358 Chr17:27236545..27236744 AGCCGCAAGCAGTCTGTATT Chr17:27236604..27236623 60.04 50
upstream ENSMUSE00000610357 Chr17:27238050..27238179 CCGCATCTCCTACCTGTTGT Chr17:27238076..27238095 60.13 55
upstream ENSMUSE00000610356 Chr17:27238528..27238585 GAGGCCATGTTTGGAGTAGG Chr17:27238566..27238585 59.55 55
upstream ENSMUSE00000610355 Chr17:27239712..27239877 ATGCACGACTACCCGTCTCT Chr17:27239785..27239804 59.75 55
upstream ENSMUSE00000610354 Chr17:27240778..27240942 CTGATCTCAGCCCAGGATGT Chr17:27240787..27240806 60.22 55
upstream ENSMUSE00000610353 Chr17:27241019..27241093 GCAGCGAGAACTACCAGATTG Chr17:27241065..27241085 60.03 52.38
upstream ENSMUSE00000610352 Chr17:27241470..27241595 GGTCATGCTGGACCTACTGC Chr17:27241559..27241578 60.69 60
upstream ENSMUSE00000610351 Chr17:27242439..27242561 CTGCGCTACACACACCAGTT Chr17:27242463..27242482 59.97 55
upstream ENSMUSE00000610350 Chr17:27243151..27243351 AACACTTTGTGCACCTGCTG Chr17:27243230..27243249 59.95 50
upstream ENSMUSE00000610349 Chr17:27244175..27244426 GACGACGTGGTGGTGTTCTA Chr17:27244190..27244209 59.6 55
upstream ENSMUSE00000610348 Chr17:27244555..27244680 ACGTAGACACGGAGGTGGAG Chr17:27244592..27244611 60.17 60
upstream ENSMUSE00000610347 Chr17:27244762..27244887 CTGTAACAAGCGGGAGAAGC Chr17:27244764..27244783 60.01 55
upstream ENSMUSE00000610346 Chr17:27247425..27247545 ACCAGACAATTGTGGTCCAG Chr17:27247429..27247448 58.41 50
upstream ENSMUSE00000610345 Chr17:27247776..27247966 CTGCCAACCAGTGGGACTAC Chr17:27247923..27247942 60.57 60
upstream ENSMUSE00000610344 Chr17:27248143..27248291 CATCATGGCCCTAGAAGAGC Chr17:27248148..27248167 59.8 55
upstream ENSMUSE00000610343 Chr17:27248409..27248517 TGGAGTCCGAGGAGAAGTTG Chr17:27248435..27248454 60.38 55
upstream ENSMUSE00000610342 Chr17:27248610..27248700 ATCTCCAGAACCGCAAGTCT Chr17:27248644..27248663 58.89 50
upstream ENSMUSE00000610341 Chr17:27248802..27248971 TATCACCAGCACCAAGAACG Chr17:27248884..27248903 59.72 50
upstream ENSMUSE00000437638 Chr17:27250436..27250610 CTGTCAACATGAGCGACCTG Chr17:27250542..27250561 60.46 55
upstream ENSMUSE00000388446 Chr17:27250689..27250870 GTGAGAACCACAACCGTGAC Chr17:27250845..27250864 58.99 55
upstream ENSMUSE00000549950 Chr17:27251025..27251225 GGGCTCTACATCAACGAGGA Chr17:27251133..27251152 60.22 55
upstream ENSMUSE00000473254 Chr17:27251340..27251450 TGTGACTCACGAATCCAACG Chr17:27251348..27251367 60.72 50
upstream ENSMUSE00000332752 Chr17:27251792..27251887 GAGAGCCGACATGACAGTGA Chr17:27251825..27251844 59.99 55
upstream ENSMUSE00000139631 Chr17:27251973..27252074 GAAGTGAGCCCACGTGAAGT Chr17:27252024..27252043 60.31 55
upstream ENSMUSE00000248097 Chr17:27252160..27252246 No primer for this exon
upstream ENSMUSE00000139644 Chr17:27252618..27252728 CCGCTGGCCTACTATGAGAA Chr17:27252690..27252709 60.37 55
upstream ENSMUSE00000367197 Chr17:27252831..27253023 GAGCGACTTCTTCGACCAGT Chr17:27252959..27252978 59.6 55
upstream ENSMUSE00000248011 Chr17:27253117..27253242 ATGCCGCTCATCTACTGGTT Chr17:27253119..27253138 59.72 50

*** Putative Vector Insertion (Chr 17: 27253243 - 27253553) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000247991 Chr17:27253554..27253726 TGTAGCGCTTGGTGAACAGT Chr17:27253640..27253659 59.51 50
downstream ENSMUSE00000139700 Chr17:27254111..27254275 GGAACTCCATGTCCATGACC Chr17:27254207..27254226 60.18 55
downstream ENSMUSE00000139712 Chr17:27254678..27254870 AACAGCGTCTCCTCTCGGTA Chr17:27254715..27254734 60.01 55
downstream ENSMUSE00000139612 Chr17:27255302..27255406 CCCACTACATGTGCCCATAA Chr17:27255360..27255379 59.27 50
downstream ENSMUSE00000139648 Chr17:27255490..27255617 TTCCTCAGTCCGTGGTTCAT Chr17:27255577..27255596 60.51 50
downstream ENSMUSE00000549939 Chr17:27256160..27256325 TCACCCCAAAGATGAGGTTC Chr17:27256250..27256269 59.9 50
downstream ENSMUSE00000139676 Chr17:27256813..27256973 TGCTCCAGTTTGATGTGCTC Chr17:27256879..27256898 59.99 50
downstream ENSMUSE00000139708 Chr17:27257876..27258037 AGGATGCGGATCTCATTCTG Chr17:27257967..27257986 60.18 50
downstream ENSMUSE00000438529 Chr17:27258405..27259167 CAAGGTCCACCCTGAGTCAT Chr17:27258990..27259009 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr17:27253293..27253313 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCCTTCTTCTACCCCTATGTG Chr17:27253206..27253228 60.49 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042644