Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32846
Trapped Gene
Has3 (ENSMUSG00000031910)
Vector Insertion
Chr 8: 109400894 - 109401804
Public Clones IST14097H1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 45% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000214617 (Chr8:109400792..109400893 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAGATGCTTCGAGTCTTGG Chr8:109400833..109400852 59.11 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000214617 (Chr8:109400792..109400893 +)
Downstram Exon
ENSMUSE00000634552 (Chr8:109401805..109406802 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAGATGCTTCGAGTCTTGG Chr8:109400833..109400852 59.11 50 GAGAATGCACTGCTGGTGAA Chr8:109406042..109406061 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679730 Chr8:109394142..109394314 CCTTGGCGTTCAGAAGATTT Chr8:109394273..109394292 59.31 45
upstream ENSMUSE00000214618 Chr8:109397808..109398446 CTTCTTTGTGTGGCGTAGCA Chr8:109398251..109398270 60.05 50
upstream ENSMUSE00000214617 Chr8:109400792..109400893 TGAGATGCTTCGAGTCTTGG Chr8:109400833..109400852 59.11 50

*** Putative Vector Insertion (Chr 8: 109400894 - 109401804) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000634552 Chr8:109401805..109406802 GAGAATGCACTGCTGGTGAA Chr8:109406042..109406061 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGCTTTTCTGTTTCGTGAC Chr8:109400931..109400951 59.72 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031910