Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32849
Trapped Gene
D16H22S680E (ENSMUSG00000013539)
Vector Insertion
Chr 16: 18316738 - 18324544
Public Clones IST14899D8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000129843 (Chr16:18324450..18324543 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000129843 (Chr16:18324450..18324543 -)
Downstram Exon
ENSMUSE00000129845 (Chr16:18316739..18316827 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000703647 Chr16:18343988..18344007 No primer for this exon
upstream ENSMUSE00000129843 Chr16:18324450..18324543 No primer for this exon
upstream ENSMUSE00000703631 Chr16:18324450..18324546 No primer for this exon
upstream ENSMUSE00000129845 Chr16:18316739..18316827 No primer for this exon

*** Putative Vector Insertion (Chr 16: 18316738 - 18324544) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000129848 Chr16:18312732..18312851 No primer for this exon
downstream ENSMUSE00000129846 Chr16:18310962..18311076 No primer for this exon
downstream ENSMUSE00000129849 Chr16:18308063..18308133 No primer for this exon
downstream ENSMUSE00000129844 Chr16:18303776..18303929 No primer for this exon
downstream ENSMUSE00000129850 Chr16:18302779..18302883 No primer for this exon
downstream ENSMUSE00000364418 Chr16:18300920..18301645 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCGATGACATCTCCCTACCT Chr16:18321492..18321512 59.12 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTTTTCCCACAGACCTTG Chr16:18321536..18321556 60.08 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000013539