Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32856
Trapped Gene
Gzmk (ENSMUSG00000042385)
Vector Insertion
Chr 13: 113971044 - 114013697
Public Clones IST12427B7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000712737 (Chr13:114013535..114013696 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTGTTTACCAGGCGGTCAG Chr13:114013541..114013560 60.17 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000712737 (Chr13:114013535..114013696 -)
Downstram Exon
ENSMUSE00000357247 (Chr13:113971045..113971105 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTGTTTACCAGGCGGTCAG Chr13:114013541..114013560 60.17 55 ATATAAACGCCAGCCACCAG Chr13:113971034..113971053 59.98 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000718855 Chr13:114015972..114016116 CAGAGCATGTGCAGACCAAG Chr13:114015997..114016016 60.62 55
upstream ENSMUSE00000712737 Chr13:114013535..114013696 AGTGTTTACCAGGCGGTCAG Chr13:114013541..114013560 60.17 55
upstream ENSMUSE00000357247 Chr13:113971045..113971105 GGTGGCTGGCGTTTATATGT Chr13:113971054..113971073 59.85 50

*** Putative Vector Insertion (Chr 13: 113971044 - 114013697) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000307518 Chr13:113970643..113970790 GGATCAGGACTCCTCCACAA Chr13:113970661..113970680 60.05 55
downstream ENSMUSE00000710080 Chr13:113970643..113970790 GGATCAGGACTCCTCCACAA Chr13:113970661..113970680 60.05 55
downstream ENSMUSE00000307512 Chr13:113964131..113964281 AACCGGACTGAAGTCGTGAG Chr13:113964138..113964157 60.3 55
downstream ENSMUSE00000307506 Chr13:113963093..113963362 CAGGGTATCAGAGGCGGTTA Chr13:113963200..113963219 60.09 55
downstream ENSMUSE00000639644 Chr13:113961816..113962243 CCTGAGAGACTAGGGCATGG Chr13:113962164..113962183 59.82 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCTTGGCATAATCGCCTTG Chr13:113992635..113992655 60.73 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTCTGGGAATCAGCTAAAC Chr13:113992695..113992716 60.22 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042385