Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32857
Trapped Gene
Ccdc38 (ENSMUSG00000036168)
Vector Insertion
Chr 10: 93003555 - 93008199
Public Clones IST12015H5 (tigm) IST10280E11 (tigm) IST10280E11 (tigm) IST10984H8 (tigm)
IST12660H10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000665682 (Chr10:93003377..93003554 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGTTTGGTGCCTCTGTCTG Chr10:93003477..93003496 59.46 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000665682 (Chr10:93003377..93003554 +)
Downstram Exon
ENSMUSE00000343884 (Chr10:93008200..93008250 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGTTTGGTGCCTCTGTCTG Chr10:93003477..93003496 59.46 55 ATCTGGGATGCCATTTTGTC Chr10:93008230..93008249 59.76 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000665682 Chr10:93003377..93003554 CAGTTTGGTGCCTCTGTCTG Chr10:93003477..93003496 59.46 55

*** Putative Vector Insertion (Chr 10: 93003555 - 93008199) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000343884 Chr10:93008200..93008250 ATCTGGGATGCCATTTTGTC Chr10:93008230..93008249 59.76 45
downstream ENSMUSE00000376652 Chr10:93011654..93011754 TTCCTGGCAGCAATTTCATT Chr10:93011753..93011772 60.58 40
downstream ENSMUSE00000261666 Chr10:93012907..93013072 CCCAGACGTTCATAGGAGGA Chr10:93013040..93013059 60.06 55
downstream ENSMUSE00000574124 Chr10:93018264..93018328 AACTCGTGGACCGTCCTCTT Chr10:93018297..93018316 61.08 55
downstream ENSMUSE00000640905 Chr10:93025476..93025639 AATGCGTCATCTTGGAGCTT Chr10:93025585..93025604 59.84 45
downstream ENSMUSE00000640904 Chr10:93025950..93026030 CCATGCTTGCTTTCTTGAGC Chr10:93026014..93026033 61.05 50
downstream ENSMUSE00000640903 Chr10:93028539..93028690 GTGGTTGCTTTTGGACGACT Chr10:93028671..93028690 60.16 50
downstream ENSMUSE00000640902 Chr10:93030409..93030501 CTCGCCTTGAACTCCATTCT Chr10:93030495..93030514 59.43 50
downstream ENSMUSE00000640901 Chr10:93032621..93032678 TTGGCCCAAAGTATGTTTCC Chr10:93032655..93032674 59.8 45
downstream ENSMUSE00000640900 Chr10:93033592..93033664 No primer for this exon
downstream ENSMUSE00000640899 Chr10:93036756..93036907 GAACCAAGGTGAGGTTCTGC Chr10:93036840..93036859 59.7 55
downstream ENSMUSE00000640898 Chr10:93038018..93038153 CCTTCTCCTCCTCTCGTTCA Chr10:93038094..93038113 59.53 55
downstream ENSMUSE00000574123 Chr10:93041454..93041636 GCTTTCCATGTAGGCTCCTG Chr10:93041494..93041513 59.84 55
downstream ENSMUSE00000640897 Chr10:93042507..93042712 ATCGCTTCCACGTGTTCTCT Chr10:93042682..93042701 59.87 50
downstream ENSMUSE00000640896 Chr10:93044478..93044571 TTCCAGAGCAGCTTTTAGCC Chr10:93044547..93044566 59.73 50
downstream ENSMUSE00000574122 Chr10:93045187..93047071 GTACATAGATGGGGCGCTGT Chr10:93046825..93046844 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGATTATACACCACCACCAAGG Chr10:93003581..93003603 59.61 45.46 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGATTATACACCACCACCAAGG Chr10:93003581..93003603 59.61 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036168