Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32859
Trapped Gene
Park2 (ENSMUSG00000023826)
Vector Insertion
Chr 17: 11260159 - 11430327
Public Clones (sanger) IST14746D12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 38% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000703888 (Chr17:11259992..11260158 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGCTTCCGAATCACCTGAC Chr17:11260132..11260151 59.81 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000703888 (Chr17:11259992..11260158 +)
Downstram Exon
ENSMUSE00000464625 (Chr17:11430328..11430568 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGCTTCCGAATCACCTGAC Chr17:11260132..11260151 59.81 55 ACTCCCATATGGAGCCCTCT Chr17:11430454..11430473 59.92 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000485440 Chr17:11259991..11260158 GAGCTTCCGAATCACCTGAC Chr17:11260132..11260151 59.81 55
upstream ENSMUSE00000703888 Chr17:11259992..11260158 GAGCTTCCGAATCACCTGAC Chr17:11260132..11260151 59.81 55

*** Putative Vector Insertion (Chr 17: 11260159 - 11430327) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000464625 Chr17:11430328..11430568 ACTCCCATATGGAGCCCTCT Chr17:11430454..11430473 59.92 55
downstream ENSMUSE00000703887 Chr17:11433083..11433111 No primer for this exon
downstream ENSMUSE00000479958 Chr17:11496459..11496577 CTGAACTCGGAGCTTTCCAG Chr17:11496541..11496560 60.13 55
downstream ENSMUSE00000482806 Chr17:11627416..11627499 ACTCACCACTCATCCGGTTT Chr17:11627470..11627489 59.43 50
downstream ENSMUSE00000481965 Chr17:11685545..11685660 TTGGGTGTGCTCCACATTTA Chr17:11685578..11685597 59.96 45
downstream ENSMUSE00000477260 Chr17:11828176..11828312 ATCACGTGACGGTGGTTACA Chr17:11828220..11828239 59.88 50
downstream ENSMUSE00000429057 Chr17:12031468..12031529 AATCAGGGAGTTGGGACAGC Chr17:12031493..12031512 61.43 55
downstream ENSMUSE00000429034 Chr17:12047593..12047742 CCCTGTTCAGGTAGCAGTCC Chr17:12047699..12047718 59.72 60
downstream ENSMUSE00000429026 Chr17:12196911..12196994 GAGGGTTCGAGCAGTGAGTC Chr17:12196981..12197000 59.99 60
downstream ENSMUSE00000470638 Chr17:12243492..12243609 GACAAGGCTTGGTGGTCTTC Chr17:12243582..12243601 59.7 55
downstream ENSMUSE00000510700 Chr17:12254407..12256227 TGACAGTCTGGGTACCACCA Chr17:12256201..12256220 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCTTTCATAATCGCCTTGC Chr17:11419202..11419222 61.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAATGATACCTGCGTGACTGG Chr17:11419198..11419219 60.01 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023826