Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32864
Trapped Gene
Mageb18 (ENSMUSG00000067649)
Vector Insertion
Chr X: 89370338 - 89768169
Public Clones IST10790D11 (tigm) IST13334H6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000697545 (ChrX:89768082..89768168 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGCAGTGAAAAAGCATCTG ChrX:89768125..89768144 59.99 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000697545 (ChrX:89768082..89768168 -)
Downstram Exon
ENSMUSE00000697544 (ChrX:89370339..89370431 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGCAGTGAAAAAGCATCTG ChrX:89768125..89768144 59.99 45 CTCCTCTTGTAGGGCAGGTG ChrX:89370356..89370375 59.86 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000697547 ChrX:89844788..89844911 GCCATGAAAATTCCCAGCTA ChrX:89844857..89844876 60.04 45
upstream ENSMUSE00000697546 ChrX:89781620..89781665 No primer for this exon
upstream ENSMUSE00000697545 ChrX:89768082..89768168 TGGCAGTGAAAAAGCATCTG ChrX:89768125..89768144 59.99 45
upstream ENSMUSE00000697544 ChrX:89370339..89370431 CACCTGCCCTACAAGAGGAG ChrX:89370378..89370397 59.86 60

*** Putative Vector Insertion (Chr X: 89370338 - 89768169) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000550391 ChrX:89364990..89365973 ACCGTGGCTCTTGAATATGG ChrX:89364996..89365015 59.96 50
downstream ENSMUSE00000697543 ChrX:89364218..89366030 CCCAGACGTCAACCTTTGAT ChrX:89364808..89364827 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATTAATCGCCTTGCAGCAC ChrX:89645101..89645121 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGCCTGCCTTCAGTAAACAG ChrX:89645182..89645203 60.8 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000067649