Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32878
Trapped Gene
Smyd4 (ENSMUSG00000018809)
Vector Insertion
Chr 11: 75195897 - 75200912
Public Clones (cmhd) IST14987G3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000387423 (Chr11:75195752..75195896 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000387423 (Chr11:75195752..75195896 +)
Downstram Exon
ENSMUSE00000347031 (Chr11:75200913..75201002 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000443502 Chr11:75162000..75162253 No primer for this exon
upstream ENSMUSE00000333804 Chr11:75163171..75163316 No primer for this exon
upstream ENSMUSE00000387423 Chr11:75195752..75195896 No primer for this exon

*** Putative Vector Insertion (Chr 11: 75195897 - 75200912) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000347031 Chr11:75200913..75201002 No primer for this exon
downstream ENSMUSE00000380554 Chr11:75203574..75204729 No primer for this exon
downstream ENSMUSE00000110532 Chr11:75213103..75213285 No primer for this exon
downstream ENSMUSE00000110531 Chr11:75213784..75213947 No primer for this exon
downstream ENSMUSE00000110533 Chr11:75215620..75215752 No primer for this exon
downstream ENSMUSE00000110530 Chr11:75216611..75216727 No primer for this exon
downstream ENSMUSE00000299789 Chr11:75216919..75217042 No primer for this exon
downstream ENSMUSE00000338606 Chr11:75218268..75219207 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCACTTCCAGCCCCATAATC Chr11:75198933..75198953 59.89 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCCAACCAGCAGTTGAACA Chr11:75198907..75198927 59.73 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018809