Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32888
Trapped Gene
Tmem107 (ENSMUSG00000020895)
Vector Insertion
Chr 11: 68885924 - 68886529
Public Clones IST13842H4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000588785 (Chr11:68885925..68886794 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000588785 (Chr11:68885925..68886794 +)
Downstram Exon
ENSMUSE00000588787 (Chr11:68886248..68886528 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000414589 Chr11:68884311..68884535 No primer for this exon
upstream ENSMUSE00000588786 Chr11:68884314..68884535 No primer for this exon
upstream ENSMUSE00000111984 Chr11:68884726..68884793 No primer for this exon
upstream ENSMUSE00000111987 Chr11:68884876..68884976 No primer for this exon

*** Putative Vector Insertion (Chr 11: 68885924 - 68886529) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000466325 Chr11:68885925..68886021 No primer for this exon
downstream ENSMUSE00000588785 Chr11:68885925..68886794 No primer for this exon
downstream ENSMUSE00000588787 Chr11:68886248..68886528 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTGTGGCCCTGTCTTTCTT Chr11:68885949..68885969 59.84 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTGTGGCCCTGTCTTTCTT Chr11:68885949..68885969 59.84 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020895