Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32895
Trapped Gene
Dpp8 (ENSMUSG00000032393)
Vector Insertion
Chr 9: 64908090 - 64911233
Public Clones IST12516F3 (tigm) IST13384C1 (tigm) IST12418B9 (tigm) IST13725F2 (tigm)
IST12274E3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 59% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000532739 (Chr9:64908010..64908089 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCAGTGGTGAATGGGAAGT Chr9:64908048..64908067 59.28 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000532739 (Chr9:64908010..64908089 +)
Downstram Exon
ENSMUSE00000532736 (Chr9:64911234..64911386 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCAGTGGTGAATGGGAAGT Chr9:64908048..64908067 59.28 50 CCAGGGTTTGCATAACTGGT Chr9:64911334..64911353 59.85 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000427246 Chr9:64880265..64880430 CGCTTTTAAGTCCCTTCGTC Chr9:64880276..64880295 58.97 50
upstream ENSMUSE00000382649 Chr9:64882682..64882818 CTTAAAGTTGGGCCAGGTGA Chr9:64882747..64882766 60.1 50
upstream ENSMUSE00000532751 Chr9:64884776..64885048 GAACAGCTGGGTGTCGAGAT Chr9:64884808..64884827 60.27 55
upstream ENSMUSE00000532750 Chr9:64890071..64890183 GCCCCTTTTGGATCTTTTTC Chr9:64890162..64890181 59.89 45
upstream ENSMUSE00000532749 Chr9:64891493..64891666 AGAAAGAAAGCGCATTGGAA Chr9:64891540..64891559 59.96 40
upstream ENSMUSE00000532748 Chr9:64893427..64893595 AGAGCGGAGGATCACATACG Chr9:64893567..64893586 60.24 55
upstream ENSMUSE00000532747 Chr9:64899197..64899307 CTACTGGTGGTGTCCCCAAG Chr9:64899279..64899298 60.41 60
upstream ENSMUSE00000532746 Chr9:64900852..64900980 AAACAAGGAGGGCAGATTCC Chr9:64900942..64900961 60.44 50
upstream ENSMUSE00000532745 Chr9:64901576..64901637 TCGGAGATTGTTGTTGATGC Chr9:64901608..64901627 59.65 45
upstream ENSMUSE00000532744 Chr9:64902226..64902326 No primer for this exon
upstream ENSMUSE00000532743 Chr9:64902635..64902812 AAGATGATGCCATGGACAGA Chr9:64902715..64902734 59.04 45
upstream ENSMUSE00000532741 Chr9:64903599..64903758 AACGGTCCAGTGGTGGACTA Chr9:64903729..64903748 60.42 55
upstream ENSMUSE00000532739 Chr9:64908010..64908089 ACCAGTGGTGAATGGGAAGT Chr9:64908048..64908067 59.28 50

*** Putative Vector Insertion (Chr 9: 64908090 - 64911233) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000532736 Chr9:64911234..64911386 CCAGGGTTTGCATAACTGGT Chr9:64911334..64911353 59.85 50
downstream ENSMUSE00000532734 Chr9:64911626..64911761 CTGCTGAATCCAAAATGGTG Chr9:64911764..64911783 59.12 45
downstream ENSMUSE00000532732 Chr9:64914158..64914303 TCTGGAGGGGTGTAGTCAGG Chr9:64914188..64914207 60.1 60
downstream ENSMUSE00000532731 Chr9:64922246..64922392 GGTGTTCAGGCGGAAATACT Chr9:64922302..64922321 59.06 50
downstream ENSMUSE00000532730 Chr9:64923543..64923695 CCCACTCGATCCAAGTCAAT Chr9:64923628..64923647 59.93 50
downstream ENSMUSE00000532728 Chr9:64925770..64925912 AAGATCCACAGGGTGACTGG Chr9:64925810..64925829 59.96 55
downstream ENSMUSE00000532727 Chr9:64926481..64926592 ATCCAAGAACCCATGCAAGA Chr9:64926520..64926539 60.46 45
downstream ENSMUSE00000219352 Chr9:64928538..64930457 AAAGCTCATGCTTCCCTTCA Chr9:64930014..64930033 59.96 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAGCTCACGTTATCACTGGT Chr9:64911091..64911112 60.19 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAGCTCACGTTATCACTGGT Chr9:64911091..64911112 60.19 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032393