Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/pcr.php on line 116
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32896
Trapped Gene
AL954813.14 (ENSMUSG00000082443)
Vector Insertion
Chr 4: 87226822 - 87227020
Public Clones IST13725F2 (tigm) IST12274E3 (tigm) IST12418B9 (tigm) IST13384C1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000721832 (Chr4:87226693..87226821 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCCAGTGCGGCAAATACAT Chr4:87226710..87226729 60.36 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000721832 (Chr4:87226693..87226821 +)
Downstram Exon
ENSMUSE00000721478 (Chr4:87227021..87227209 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCCAGTGCGGCAAATACAT Chr4:87226710..87226729 60.36 45 GAAGCAGCGGTTCAAGAAGT Chr4:87227086..87227105 59.62 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000721832 Chr4:87226693..87226821 ATCCAGTGCGGCAAATACAT Chr4:87226710..87226729 60.36 45

*** Putative Vector Insertion (Chr 4: 87226822 - 87227020) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000721478 Chr4:87227021..87227209 GAAGCAGCGGTTCAAGAAGT Chr4:87227086..87227105 59.62 50
downstream ENSMUSE00000714822 Chr4:87227403..87227464 GGCATAAACTCCTTGGCATC Chr4:87227451..87227470 59.53 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGGAAAACCCATTTGCAG Chr4:87226780..87226800 59.55 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGGAAAACCCATTTGCAG Chr4:87226780..87226800 59.55 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000082443