Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32901
Trapped Gene
Pkd1l1 (ENSMUSG00000046634)
Vector Insertion
Chr 11: 8816249 - 8829479
Public Clones (sanger) (sanger) IST10885F2 (tigm) IST14740H7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 38% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000581114 (Chr11:8829358..8829478 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTGTACCGTGGTCAAGACA Chr11:8829409..8829428 59.59 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000581114 (Chr11:8829358..8829478 -)
Downstram Exon
ENSMUSE00000581113 (Chr11:8816250..8816361 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTGTACCGTGGTCAAGACA Chr11:8829409..8829428 59.59 55 ATGGTAACGGGGTAGCACAG Chr11:8816254..8816273 59.88 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000581129 Chr11:8872947..8873268 GGCAGGTGCAACTACTGTGA Chr11:8872971..8872990 59.9 55
upstream ENSMUSE00000581128 Chr11:8865052..8865219 CTCAAGGCTGTTGTCCATGA Chr11:8865186..8865205 59.83 50
upstream ENSMUSE00000581127 Chr11:8862597..8862716 CAGTCGTGGTGCATTGTTTT Chr11:8862694..8862713 59.62 45
upstream ENSMUSE00000581126 Chr11:8861929..8862097 GGAGTTCGCTTGGTATTTCG Chr11:8861993..8862012 59.71 50
upstream ENSMUSE00000581125 Chr11:8861260..8861499 TCTCTGAACCCCACCTCATC Chr11:8861436..8861455 60.05 55
upstream ENSMUSE00000581124 Chr11:8858854..8858986 AACCACCCCCAGTGAAGAAC Chr11:8858875..8858894 61.18 55
upstream ENSMUSE00000581123 Chr11:8853865..8854071 CATCATGCTCCCAAGCTACA Chr11:8853900..8853919 59.82 50
upstream ENSMUSE00000581122 Chr11:8850352..8850533 CGTCATCTCTGAAGGCACAC Chr11:8850440..8850459 59.42 55
upstream ENSMUSE00000581121 Chr11:8847148..8847369 TGGCCCTGCTTTGATAACTC Chr11:8847313..8847332 60.21 50
upstream ENSMUSE00000581120 Chr11:8845188..8845348 TCCCAGACCTCACGTATTCC Chr11:8845234..8845253 59.93 55
upstream ENSMUSE00000581119 Chr11:8841905..8842246 TTGGGACCAGTCTGAAGTCC Chr11:8842185..8842204 60.09 55
upstream ENSMUSE00000581118 Chr11:8841044..8841103 TAGCGACATCCAAGAAGCAG Chr11:8841068..8841087 59.17 50
upstream ENSMUSE00000581117 Chr11:8836848..8837024 CCAGTTATGGGGACAACCTG Chr11:8836951..8836970 60.22 55
upstream ENSMUSE00000581116 Chr11:8833643..8833720 TCACTGAGCAGTGGCAAGAC Chr11:8833666..8833685 60.19 55
upstream ENSMUSE00000581115 Chr11:8831552..8831694 GCATGTCTTACTGGGCAAGG Chr11:8831668..8831687 60.66 55
upstream ENSMUSE00000581114 Chr11:8829358..8829478 CCTGTACCGTGGTCAAGACA Chr11:8829409..8829428 59.59 55
upstream ENSMUSE00000581113 Chr11:8816250..8816361 CTGTGCTACCCCGTTACCAT Chr11:8816276..8816295 59.88 55

*** Putative Vector Insertion (Chr 11: 8816249 - 8829479) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000581112 Chr11:8809804..8810002 ACATACAAGCGGCTCAGGAT Chr11:8809873..8809892 59.72 50
downstream ENSMUSE00000581111 Chr11:8808672..8808728 No primer for this exon
downstream ENSMUSE00000581110 Chr11:8802412..8802621 TCCTGCAGATAGTCCCCATC Chr11:8802424..8802443 60.03 55
downstream ENSMUSE00000581109 Chr11:8801145..8801360 CTCTGAGGGCTACGATGGAG Chr11:8801280..8801299 59.97 60
downstream ENSMUSE00000581108 Chr11:8790660..8790770 GTCTTCTTCCCCAAACTCCA Chr11:8790644..8790663 59.11 50
downstream ENSMUSE00000581107 Chr11:8790391..8790545 ACATTCACCTCATCCCGAAG Chr11:8790474..8790493 59.93 50
downstream ENSMUSE00000581106 Chr11:8789030..8789130 GACCCGCTTCACAAGAAAAT Chr11:8789063..8789082 59.17 45
downstream ENSMUSE00000581105 Chr11:8786576..8786768 ACGATCCTGGCTGTGGATAG Chr11:8786576..8786595 60.1 55
downstream ENSMUSE00000371892 Chr11:8781401..8781484 CAGAGACAGGTGCAAGGTGA Chr11:8781437..8781456 60.02 55
downstream ENSMUSE00000373525 Chr11:8779103..8779310 AAAATACCGGGGAGCAAGTT Chr11:8779259..8779278 59.83 45
downstream ENSMUSE00000337982 Chr11:8775655..8775761 GCCTGGAATTCCTTCCAAAT Chr11:8775649..8775668 60.26 45
downstream ENSMUSE00000373117 Chr11:8774102..8774318 AGAGGCGGATCTTCTGGAGT Chr11:8774256..8774275 60.36 55
downstream ENSMUSE00000354314 Chr11:8771707..8771880 TGTTGATGGTCTCGCACAGT Chr11:8771686..8771705 60.32 50
downstream ENSMUSE00000402878 Chr11:8770208..8770327 GACAGAAGCTGTGCAACTGG Chr11:8770208..8770227 59.62 55
downstream ENSMUSE00000362346 Chr11:8770052..8770121 CACTGTGTTGAAGCCTGCAT Chr11:8770065..8770084 59.9 50
downstream ENSMUSE00000399659 Chr11:8769461..8769504 GCTGCCTTGAATCTGGTCTC Chr11:8769447..8769466 59.96 55
downstream ENSMUSE00000336750 Chr11:8768460..8768616 ATTGGGAACGGTGAACAGAC Chr11:8768506..8768525 59.83 50
downstream ENSMUSE00000387886 Chr11:8767134..8767269 CTGGGACCCAAGTTCTTCAA Chr11:8767213..8767232 60.08 50
downstream ENSMUSE00000344862 Chr11:8766095..8766179 AGCCACCACATACACTGTGC Chr11:8766128..8766147 59.63 55
downstream ENSMUSE00000368126 Chr11:8765485..8765661 GAACACGGGTTCTGGAATGT Chr11:8765513..8765532 59.83 50
downstream ENSMUSE00000352032 Chr11:8763806..8763924 GAGCTTAGCCTTGGATGGTG Chr11:8763837..8763856 59.84 55
downstream ENSMUSE00000488867 Chr11:8761199..8761309 TTTCCTGATGGCATGATTGA Chr11:8761188..8761207 60.01 40
downstream ENSMUSE00000477426 Chr11:8757039..8757159 TCCAGTCCCACCAGTCTTCT Chr11:8757082..8757101 59.68 55
downstream ENSMUSE00000462946 Chr11:8756263..8756346 GCAGTGCCAGCAGAAATCTT Chr11:8756248..8756267 60.55 50
downstream ENSMUSE00000465514 Chr11:8755566..8755714 CAGGGGACACATTTTGGTTC Chr11:8755605..8755624 60.21 50
downstream ENSMUSE00000466504 Chr11:8754346..8754580 CAGGATCACGCTTGTGAAGA Chr11:8754432..8754451 59.98 50
downstream ENSMUSE00000483403 Chr11:8749658..8749762 GGAAACAGAGGTGGATCACG Chr11:8749701..8749720 60.51 55
downstream ENSMUSE00000581103 Chr11:8748921..8749061 GAACTGGTCGGTGATGTTCA Chr11:8748956..8748975 59.53 50
downstream ENSMUSE00000581102 Chr11:8744544..8744669 CACTGCTGAGAAGGGTGTCA Chr11:8744549..8744568 60.02 55
downstream ENSMUSE00000581101 Chr11:8736206..8736436 CCGTGGTCAGACTTCAAACA Chr11:8736245..8736264 59.72 50
downstream ENSMUSE00000581100 Chr11:8734777..8734935 CCCAGAAGGGTGAGGACTTT Chr11:8734798..8734817 60.48 55
downstream ENSMUSE00000581099 Chr11:8733777..8733947 AACTGCCAACTGGAGGACTG Chr11:8733775..8733794 60.3 55
downstream ENSMUSE00000581098 Chr11:8726728..8726810 CAGCAGCTAAGGGACCAGAT Chr11:8726767..8726786 59.45 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACAT Chr11:8823409..8823430 60.62 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCACATACGTGACTGGGAAAA Chr11:8823414..8823435 59.04 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000046634