Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32914
Trapped Gene
Tpd52l1 (ENSMUSG00000000296)
Vector Insertion
Chr 10: 31099020 - 31165728
Public Clones IST14131E7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000666503 (Chr10:31165518..31165727 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000666503 (Chr10:31165518..31165727 -)
Downstram Exon
ENSMUSE00000359105 (Chr10:31099021..31099136 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000666503 Chr10:31165518..31165727 No primer for this exon
upstream ENSMUSE00000359105 Chr10:31099021..31099136 No primer for this exon

*** Putative Vector Insertion (Chr 10: 31099020 - 31165728) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000098055 Chr10:31077678..31077826 No primer for this exon
downstream ENSMUSE00000098058 Chr10:31066417..31066518 No primer for this exon
downstream ENSMUSE00000098054 Chr10:31060946..31060984 No primer for this exon
downstream ENSMUSE00000098057 Chr10:31057991..31058051 No primer for this exon
downstream ENSMUSE00000644287 Chr10:31052186..31052775 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCCAAAATAATCGCCTTGC Chr10:31105665..31105685 61.42 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCTCCAGCCATCATTCTCC Chr10:31105736..31105756 59.62 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000296