Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32921
Trapped Gene
Wars2 (ENSMUSG00000004233)
Vector Insertion
Chr 3: 99009234 - 99018578
Public Clones IST12914E2 (tigm) IST11922C7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 48% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000173770 (Chr3:99009148..99009233 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000173770 (Chr3:99009148..99009233 +)
Downstram Exon
ENSMUSE00000173771 (Chr3:99018579..99018697 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000243764 Chr3:98945013..98945111 No primer for this exon
upstream ENSMUSE00000243754 Chr3:98991404..98991661 No primer for this exon
upstream ENSMUSE00000243745 Chr3:99008459..99008539 No primer for this exon
upstream ENSMUSE00000173770 Chr3:99009148..99009233 No primer for this exon

*** Putative Vector Insertion (Chr 3: 99009234 - 99018578) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000173771 Chr3:99018579..99018697 No primer for this exon
downstream ENSMUSE00000173769 Chr3:99020382..99024126 No primer for this exon
downstream ENSMUSE00000671830 Chr3:99039402..99039453 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATCGAAGCTAATCGCCTTG Chr3:99015276..99015296 59.94 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATTGAAGGATGGGCGTGAC Chr3:99015271..99015291 62.77 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004233