Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32928
Trapped Gene
Fut8 (ENSMUSG00000021065)
Vector Insertion
Chr 12: 78494825 - 78513698
Public Clones IST10092B8 (tigm) IST13951A4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000395439 (Chr12:78494710..78494824 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000395439 (Chr12:78494710..78494824 +)
Downstram Exon
ENSMUSE00000114289 (Chr12:78513699..78513936 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000531291 Chr12:78340052..78340240 No primer for this exon
upstream ENSMUSE00000453763 Chr12:78378348..78378442 No primer for this exon
upstream ENSMUSE00000453723 Chr12:78424832..78424924 No primer for this exon
upstream ENSMUSE00000453743 Chr12:78432883..78433316 No primer for this exon
upstream ENSMUSE00000390365 Chr12:78465956..78466071 No primer for this exon
upstream ENSMUSE00000114291 Chr12:78466184..78466346 No primer for this exon
upstream ENSMUSE00000395439 Chr12:78494710..78494824 No primer for this exon

*** Putative Vector Insertion (Chr 12: 78494825 - 78513698) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000114289 Chr12:78513699..78513936 No primer for this exon
downstream ENSMUSE00000114293 Chr12:78549460..78549706 No primer for this exon
downstream ENSMUSE00000114292 Chr12:78551087..78551263 No primer for this exon
downstream ENSMUSE00000114294 Chr12:78565047..78565197 No primer for this exon
downstream ENSMUSE00000531290 Chr12:78575986..78577325 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTCCAGCGGAGAATAACAT Chr12:78494798..78494818 59.01 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTCCAGCGGAGAATAACAT Chr12:78494798..78494818 59.01 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021065