Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32947
Trapped Gene
Kctd2 (ENSMUSG00000016940)
Vector Insertion
Chr 11: 115281821 - 115283296
Public Clones IST11202A11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 43% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000670376 (Chr11:115281464..115281820 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000670376 (Chr11:115281464..115281820 +)
Downstram Exon
ENSMUSE00000108830 (Chr11:115283297..115283405 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000661088 Chr11:115281440..115281820 No primer for this exon
upstream ENSMUSE00000670376 Chr11:115281464..115281820 No primer for this exon

*** Putative Vector Insertion (Chr 11: 115281821 - 115283296) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000108830 Chr11:115283297..115283405 No primer for this exon
downstream ENSMUSE00000108828 Chr11:115285798..115285889 No primer for this exon
downstream ENSMUSE00000108827 Chr11:115288747..115288842 No primer for this exon
downstream ENSMUSE00000646244 Chr11:115290594..115292588 No primer for this exon
downstream ENSMUSE00000661087 Chr11:115290594..115290719 No primer for this exon
downstream ENSMUSE00000670378 Chr11:115291200..115291286 No primer for this exon
downstream ENSMUSE00000661086 Chr11:115291627..115292587 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGCTGGACTCCGACAAGGT Chr11:115281804..115281824 61.78 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGCTGGACTCCGACAAGGT Chr11:115281804..115281824 61.78 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000016940