Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3295
Trapped Gene
Rps25 (ENSMUSG00000009927)
Vector Insertion
Chr 9: 44218136 - 44218228
Public Clones AD0830 (sanger) AS0591 (sanger)
Private Clones OST220832 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000496355 (Chr9:44218037..44218135 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000496355 (Chr9:44218037..44218135 +)
Downstram Exon
ENSMUSE00000700449 (Chr9:44218229..44218272 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000700453 Chr9:44215797..44215840 No primer for this exon
upstream ENSMUSE00000501535 Chr9:44216071..44216166 No primer for this exon
upstream ENSMUSE00000502462 Chr9:44216769..44216952 No primer for this exon
upstream ENSMUSE00000496355 Chr9:44218037..44218135 No primer for this exon

*** Putative Vector Insertion (Chr 9: 44218136 - 44218228) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000700449 Chr9:44218229..44218272 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGAAGATGCATGAACAGGTG Chr9:44218120..44218140 60.26 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGACGTGACTGGGAAAACC Chr9:44218183..44218203 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000009927