Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32962
Trapped Gene
Klhl29 (ENSMUSG00000020627)
Vector Insertion
Chr 12: 5147372 - 5217068
Public Clones IST14940A4 (tigm) IST14221F1 (tigm) IST14417A3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000426135 (Chr12:5216738..5217067 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000426135 (Chr12:5216738..5217067 -)
Downstram Exon
ENSMUSE00000389734 (Chr12:5147373..5147514 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000426174 Chr12:5381908..5382488 No primer for this exon
upstream ENSMUSE00000426142 Chr12:5298143..5298250 No primer for this exon
upstream ENSMUSE00000426135 Chr12:5216738..5217067 No primer for this exon
upstream ENSMUSE00000389734 Chr12:5147373..5147514 No primer for this exon

*** Putative Vector Insertion (Chr 12: 5147372 - 5217068) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000351497 Chr12:5144229..5144741 No primer for this exon
downstream ENSMUSE00000107226 Chr12:5109495..5109633 No primer for this exon
downstream ENSMUSE00000107225 Chr12:5101623..5101825 No primer for this exon
downstream ENSMUSE00000107223 Chr12:5100292..5100551 No primer for this exon
downstream ENSMUSE00000107224 Chr12:5098048..5098246 No primer for this exon
downstream ENSMUSE00000107212 Chr12:5097725..5097907 No primer for this exon
downstream ENSMUSE00000107222 Chr12:5097342..5097522 No primer for this exon
downstream ENSMUSE00000348792 Chr12:5091100..5091293 No primer for this exon
downstream ENSMUSE00000107220 Chr12:5090698..5090842 No primer for this exon
downstream ENSMUSE00000107215 Chr12:5085903..5088140 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGTGAAATAATCGCCTTGC Chr12:5160005..5160025 59.19 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGACTGCCTATCGTGACTGG Chr12:5160008..5160028 59.85 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020627