Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32966
Trapped Gene
Nr4a1 (ENSMUSG00000023034)
Vector Insertion
Chr 15: 101103625 - 101104426
Public Clones IST11910G7 (tigm) IST13795A12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 86% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000132953 (Chr15:101103446..101103624 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCTTGGGTGTTGATGTTCC Chr15:101103567..101103586 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000132953 (Chr15:101103446..101103624 +)
Downstram Exon
ENSMUSE00000383435 (Chr15:101104427..101105223 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCTTGGGTGTTGATGTTCC Chr15:101103567..101103586 59.97 50 CGGAAGAGATCTCGAGTTGG Chr15:101105081..101105100 59.94 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000132954 Chr15:101097284..101097402 TTGGGGGAGTGTGCTAGAAG Chr15:101097304..101097323 60.25 55
upstream ENSMUSE00000132956 Chr15:101100514..101101400 CTTGAGTTCGGCAAGCCTAC Chr15:101100597..101100616 60.01 55
upstream ENSMUSE00000132957 Chr15:101102167..101102296 AAAGCGCCAAGTACATCTGC Chr15:101102180..101102199 60.42 50
upstream ENSMUSE00000132955 Chr15:101102584..101102735 AGATGCCTCCCCTACCAATC Chr15:101102648..101102667 60.29 55
upstream ENSMUSE00000132951 Chr15:101103149..101103351 TATCCGAAAGTGGGCAGAAA Chr15:101103238..101103257 60.58 45
upstream ENSMUSE00000132953 Chr15:101103446..101103624 AGCTTGGGTGTTGATGTTCC Chr15:101103567..101103586 59.97 50

*** Putative Vector Insertion (Chr 15: 101103625 - 101104426) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000383435 Chr15:101104427..101105223 CGGAAGAGATCTCGAGTTGG Chr15:101105081..101105100 59.94 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA Chr15:101103674..101103694 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCACTGGTGAGTGGCAGAAA Chr15:101103620..101103640 60.44 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023034