Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32968
Trapped Gene
Notch1 (ENSMUSG00000026923)
Vector Insertion
Chr 2: 26359017 - 26365178
Public Clones IST10281C1 (tigm) IST12747G6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000697990 (Chr2:26365132..26365177 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACAAATGGAGGATGGAGCAA Chr2:26365133..26365152 60.46 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000697990 (Chr2:26365132..26365177 -)
Downstram Exon
ENSMUSE00000333372 (Chr2:26359018..26359318 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACAAATGGAGGATGGAGCAA Chr2:26365133..26365152 60.46 45 CACCCTCTGATGCCCTCTTT Chr2:26359155..26359174 61.55 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000697990 Chr2:26365132..26365177 ACAAATGGAGGATGGAGCAA Chr2:26365133..26365152 60.46 45
upstream ENSMUSE00000333372 Chr2:26359018..26359318 AGGAAAGAGGGCATCAGAGG Chr2:26359180..26359199 60.72 55

*** Putative Vector Insertion (Chr 2: 26359017 - 26365178) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000164286 Chr2:26357401..26357479 No primer for this exon
downstream ENSMUSE00000164298 Chr2:26340707..26340969 GCGGCACTTGTACTCTGTGA Chr2:26340704..26340723 60.06 55
downstream ENSMUSE00000164287 Chr2:26339788..26340126 GGCAGCGACAGATGTATGAA Chr2:26340009..26340028 59.83 50
downstream ENSMUSE00000568974 Chr2:26337091..26337213 GCAGCGGCAATTGTAGGTAT Chr2:26337085..26337104 60.12 50
downstream ENSMUSE00000568973 Chr2:26336494..26336727 CAGTCCACCCATTGACACAC Chr2:26336586..26336605 59.85 55
downstream ENSMUSE00000568972 Chr2:26335744..26335899 TGACAGGGTTGGTGTCACAG Chr2:26335800..26335819 60.63 55
downstream ENSMUSE00000164293 Chr2:26335391..26335576 GTCCCGTGTAGCCCTGTAGA Chr2:26335471..26335490 60.13 60
downstream ENSMUSE00000164282 Chr2:26334967..26335080 GGCACTGACATTGGAACTCAT Chr2:26334951..26334971 59.99 47.62
downstream ENSMUSE00000164308 Chr2:26334127..26334240 CCACATCATACTGGCACAGG Chr2:26334186..26334205 59.98 55
downstream ENSMUSE00000164277 Chr2:26333590..26333823 GTGGCACTCATTGATGTTGG Chr2:26333647..26333666 59.97 50
downstream ENSMUSE00000662975 Chr2:26333400..26333510 TTCACAGGCACATTCGTAGC Chr2:26333391..26333410 59.87 50
downstream ENSMUSE00000662974 Chr2:26332467..26332659 GGGGTTACTGTTGCACTCGT Chr2:26332480..26332499 60.03 55
downstream ENSMUSE00000164302 Chr2:26331868..26332013 GGGTTGGACTCACACTCGTT Chr2:26331917..26331936 60.01 55
downstream ENSMUSE00000164301 Chr2:26331594..26331707 AGGCACATTCGTTGATGTTG Chr2:26331650..26331669 59.57 45
downstream ENSMUSE00000698006 Chr2:26329663..26329760 GTTTTTGCAGGGGCTGGTAG Chr2:26329686..26329705 61.9 55
downstream ENSMUSE00000164276 Chr2:26329641..26329760 CTGTGGGACAGACACAGGAA Chr2:26329628..26329647 59.71 55
downstream ENSMUSE00000164304 Chr2:26329201..26329353 GGTAGCTGCCATTGGTGTTC Chr2:26329245..26329264 60.53 55
downstream ENSMUSE00000164288 Chr2:26328304..26328532 GGTGTGTTGTTCTCGCAGTG Chr2:26328297..26328316 60.36 55
downstream ENSMUSE00000698005 Chr2:26328304..26328533 GATTGCTGGCACATTCATTG Chr2:26328394..26328413 60.08 45
downstream ENSMUSE00000164273 Chr2:26327591..26327792 GCCGTGAATCACACTCATTG Chr2:26327655..26327674 60.12 50
downstream ENSMUSE00000697989 Chr2:26327591..26327792 GCCGTGAATCACACTCATTG Chr2:26327655..26327674 60.12 50
downstream ENSMUSE00000697988 Chr2:26326685..26326825 ACAGTGGTACTGCGTGTTGG Chr2:26326726..26326745 59.67 55
downstream ENSMUSE00000164283 Chr2:26326672..26326825 ACAGTGGTACTGCGTGTTGG Chr2:26326726..26326745 59.67 55
downstream ENSMUSE00000164290 Chr2:26326342..26326526 GGGTTAGGTGAGCACTCGTC Chr2:26326372..26326391 59.73 60
downstream ENSMUSE00000697987 Chr2:26326342..26326528 GGGTTAGGTGAGCACTCGTC Chr2:26326372..26326391 59.73 60
downstream ENSMUSE00000164291 Chr2:26325794..26325926 GGACAGGCACTCGTTGATCT Chr2:26325848..26325867 60.27 55
downstream ENSMUSE00000697986 Chr2:26325794..26325926 GGACAGGCACTCGTTGATCT Chr2:26325848..26325867 60.27 55
downstream ENSMUSE00000164295 Chr2:26325321..26325578 TCATTAACACGCTGCACACA Chr2:26325331..26325350 59.9 45
downstream ENSMUSE00000697984 Chr2:26325321..26325578 TCATTAACACGCTGCACACA Chr2:26325331..26325350 59.9 45
downstream ENSMUSE00000698004 Chr2:26325159..26325237 CACAGACACCCCCATTCTTG Chr2:26325150..26325169 61.37 55
downstream ENSMUSE00000697983 Chr2:26325155..26325237 CACAGACACCCCCATTCTTG Chr2:26325150..26325169 61.37 55
downstream ENSMUSE00000164306 Chr2:26325125..26325237 GGGCACCTACAGATGAATCC Chr2:26325107..26325126 59.37 55
downstream ENSMUSE00000164285 Chr2:26323752..26324323 AGGGCATAGACAGCGGTAGA Chr2:26324065..26324084 59.86 55
downstream ENSMUSE00000697982 Chr2:26323752..26324272 AGGGCATAGACAGCGGTAGA Chr2:26324065..26324084 59.86 55
downstream ENSMUSE00000698003 Chr2:26323752..26324276 AGGGCATAGACAGCGGTAGA Chr2:26324065..26324084 59.86 55
downstream ENSMUSE00000697981 Chr2:26323232..26323550 GTGGCCATAGTACGGGAAGA Chr2:26323249..26323268 59.96 55
downstream ENSMUSE00000698002 Chr2:26323232..26323550 GTGGCCATAGTACGGGAAGA Chr2:26323249..26323268 59.96 55
downstream ENSMUSE00000164284 Chr2:26323149..26323550 GTGGCCATAGTACGGGAAGA Chr2:26323249..26323268 59.96 55
downstream ENSMUSE00000164281 Chr2:26321987..26322135 CGGCCTCAATCTTGTAAGGA Chr2:26321971..26321990 60.21 50
downstream ENSMUSE00000164305 Chr2:26320870..26321086 AAAGAACAGGAGCACGAAGG Chr2:26320985..26321004 59.47 50
downstream ENSMUSE00000164280 Chr2:26320583..26320670 CTCGTTCTGATTGTCGTCCA Chr2:26320597..26320616 59.83 50
downstream ENSMUSE00000164271 Chr2:26320326..26320491 TCCTCGAACATTGACATCCA Chr2:26320308..26320327 60.05 45
downstream ENSMUSE00000697980 Chr2:26320326..26320371 TCCTCGAACATTGACATCCA Chr2:26320308..26320327 60.05 45
downstream ENSMUSE00000698000 Chr2:26320326..26320371 TCCTCGAACATTGACATCCA Chr2:26320308..26320327 60.05 45
downstream ENSMUSE00000697979 Chr2:26319438..26319525 AATCATGAGGGGTGTGAAGC Chr2:26319481..26319500 59.93 50
downstream ENSMUSE00000164307 Chr2:26319230..26319525 AATCATGAGGGGTGTGAAGC Chr2:26319481..26319500 59.93 50
downstream ENSMUSE00000568959 Chr2:26317862..26318009 CAGTGGAGTTGTGCCATCAT Chr2:26317925..26317944 59.55 50
downstream ENSMUSE00000568958 Chr2:26317668..26317765 CGTTCTTCAGGAGCACAACA Chr2:26317675..26317694 60.03 50
downstream ENSMUSE00000355340 Chr2:26313556..26316496 CCTGTGTGGCAGACTTGAGA Chr2:26316192..26316211 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr2:26362108..26362128 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGAAAGAGGGCATCAGAGG Chr2:26362178..26362199 63.43 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026923