Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32970
Trapped Gene
BC031353 (ENSMUSG00000034858)
Vector Insertion
Chr 9: 74824084 - 74850538
Public Clones IST14883G7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000583952 (Chr9:74823918..74824083 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTTTGTGAGAAGCCTGCAC Chr9:74823921..74823940 60.97 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000583952 (Chr9:74823918..74824083 +)
Downstram Exon
ENSMUSE00000695870 (Chr9:74850539..74850546 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTTTGTGAGAAGCCTGCAC Chr9:74823921..74823940 60.97 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000583952 Chr9:74823918..74824083 CCTTTGTGAGAAGCCTGCAC Chr9:74823921..74823940 60.97 55

*** Putative Vector Insertion (Chr 9: 74824084 - 74850538) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000695870 Chr9:74850539..74850546 No primer for this exon
downstream ENSMUSE00000695869 Chr9:74850669..74850694 No primer for this exon
downstream ENSMUSE00000635541 Chr9:74852072..74852256 CTTGTCGCTGCATTCATGTC Chr9:74852250..74852269 60.42 50
downstream ENSMUSE00000635540 Chr9:74854095..74854297 TACTAGGCCCCTCGTCACTG Chr9:74854215..74854234 60.27 60
downstream ENSMUSE00000635539 Chr9:74854769..74854894 TTCGTGGAATAGCACCATGA Chr9:74854884..74854903 60.07 45
downstream ENSMUSE00000635538 Chr9:74856458..74858273 CATGGTGCTGACAGGCTCTA Chr9:74856684..74856703 60.01 55
downstream ENSMUSE00000635537 Chr9:74860748..74860861 TGATGTCCCATCCAAGGAAT Chr9:74860816..74860835 60.13 45
downstream ENSMUSE00000635536 Chr9:74863651..74863730 GACGCGTCTAGATCAAAGCA Chr9:74863700..74863719 59.18 50
downstream ENSMUSE00000635534 Chr9:74864845..74864953 AACATCTGGGTCCTCGTCAA Chr9:74864887..74864906 60.51 50
downstream ENSMUSE00000635533 Chr9:74866804..74866962 GGGAGCATTATCATCGGAAA Chr9:74866953..74866972 59.86 45
downstream ENSMUSE00000635531 Chr9:74871392..74871460 CCCCTTTTACCAAGGGACTC Chr9:74871429..74871448 59.8 55
downstream ENSMUSE00000635530 Chr9:74873458..74873654 TGTGCTGGACGTTCTCTTTG Chr9:74873623..74873642 60.03 50
downstream ENSMUSE00000366832 Chr9:74879322..74879890 ATCACGGGTCTCACTTCAGG Chr9:74879637..74879656 60.11 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr9:74842134..74842154 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAAGACGTGACTGGGAAAAC Chr9:74845129..74845150 59.1 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034858