Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32972
Trapped Gene
Sgpp2 (ENSMUSG00000032908)
Vector Insertion
Chr 1: 78307078 - 78356645
Public Clones IST12630A7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000352696 (Chr1:78306920..78307077 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000352696 (Chr1:78306920..78307077 +)
Downstram Exon
ENSMUSE00000344561 (Chr1:78356646..78356804 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GCTGAAAACCGGAACAGGTA Chr1:78356710..78356729 60.11 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000352696 Chr1:78306920..78307077 No primer for this exon

*** Putative Vector Insertion (Chr 1: 78307078 - 78356645) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000344561 Chr1:78356646..78356804 GCTGAAAACCGGAACAGGTA Chr1:78356710..78356729 60.11 50
downstream ENSMUSE00000263656 Chr1:78387050..78387229 GGCATTCCGTACTCTGCAAT Chr1:78387162..78387181 60.1 50
downstream ENSMUSE00000263650 Chr1:78389934..78390023 GCTGAGACACACCAGCGTAG Chr1:78389996..78390015 59.65 60
downstream ENSMUSE00000515173 Chr1:78413450..78416862 ACCCAAGTTACCAGGCACAG Chr1:78416680..78416699 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCATGCATGTAATCGCCTTG Chr1:78334120..78334140 60.63 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCTACGTGACTGGGAAAAC Chr1:78334124..78334144 59.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032908