Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32978
Trapped Gene
Kif16b (ENSMUSG00000038844)
Vector Insertion
Chr 2: 142474163 - 142498115
Public Clones IST10845F12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 94% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000682549 (Chr2:142498025..142498114 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTCAGGCGCTACAGTCGTT Chr2:142498066..142498085 59.9 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000682549 (Chr2:142498025..142498114 -)
Downstram Exon
ENSMUSE00000682548 (Chr2:142474164..142474247 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTCAGGCGCTACAGTCGTT Chr2:142498066..142498085 59.9 50 TACCCGCTCGTCTTTGTTTC Chr2:142474169..142474188 60.25 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000709272 Chr2:142727061..142727200 GAGCTATGGCATCGGTCAAG Chr2:142727093..142727112 60.76 55
upstream ENSMUSE00000719834 Chr2:142727061..142727200 GAGCTATGGCATCGGTCAAG Chr2:142727093..142727112 60.76 55
upstream ENSMUSE00000682544 Chr2:142691080..142691149 CTGGAGGCCAAGTTCATCAT Chr2:142691120..142691139 60.07 50
upstream ENSMUSE00000682562 Chr2:142691080..142691149 CTGGAGGCCAAGTTCATCAT Chr2:142691120..142691139 60.07 50
upstream ENSMUSE00000682543 Chr2:142688163..142688276 AGAACGGACCAAGACCTTCA Chr2:142688225..142688244 59.7 50
upstream ENSMUSE00000682557 Chr2:142688163..142688276 AGAACGGACCAAGACCTTCA Chr2:142688225..142688244 59.7 50
upstream ENSMUSE00000169403 Chr2:142683047..142683163 CTTTGCATATGGGCAAACTG Chr2:142683082..142683101 59.18 45
upstream ENSMUSE00000682542 Chr2:142683047..142683163 CTTTGCATATGGGCAAACTG Chr2:142683082..142683101 59.18 45
upstream ENSMUSE00000169405 Chr2:142680170..142680267 CAGTCGGATCAATGAAACCA Chr2:142680207..142680226 59.5 45
upstream ENSMUSE00000682540 Chr2:142680170..142680267 CAGTCGGATCAATGAAACCA Chr2:142680207..142680226 59.5 45
upstream ENSMUSE00000169404 Chr2:142679363..142679472 CATCCCAAAGAAGGACCGTA Chr2:142679371..142679390 59.93 50
upstream ENSMUSE00000682539 Chr2:142679363..142679472 CATCCCAAAGAAGGACCGTA Chr2:142679371..142679390 59.93 50
upstream ENSMUSE00000465969 Chr2:142675600..142675742 CATGGACGCAGGAAATATCA Chr2:142675677..142675696 59.5 45
upstream ENSMUSE00000595731 Chr2:142675600..142675742 CATGGACGCAGGAAATATCA Chr2:142675677..142675696 59.5 45
upstream ENSMUSE00000270333 Chr2:142674029..142674197 AAAATTCGACGCTGAAATGC Chr2:142674176..142674195 60.22 40
upstream ENSMUSE00000640569 Chr2:142674029..142674197 AAAATTCGACGCTGAAATGC Chr2:142674176..142674195 60.22 40
upstream ENSMUSE00000270329 Chr2:142673727..142673858 GCCAACCCTCTTGTGAAGAA Chr2:142673819..142673838 60.23 50
upstream ENSMUSE00000640568 Chr2:142673727..142673858 GCCAACCCTCTTGTGAAGAA Chr2:142673819..142673838 60.23 50
upstream ENSMUSE00000270322 Chr2:142672665..142672840 AGGATGCCAACGTCAAACTC Chr2:142672725..142672744 60.12 50
upstream ENSMUSE00000640582 Chr2:142672665..142672840 AGGATGCCAACGTCAAACTC Chr2:142672725..142672744 60.12 50
upstream ENSMUSE00000270314 Chr2:142663253..142663318 TCTTGGACTCCCCTACAGCTT Chr2:142663291..142663311 60.25 52.38
upstream ENSMUSE00000640567 Chr2:142663253..142663318 TCTTGGACTCCCCTACAGCTT Chr2:142663291..142663311 60.25 52.38
upstream ENSMUSE00000405936 Chr2:142659813..142659872 TTGACCAAGGAATGGACAAA Chr2:142659844..142659863 58.95 40
upstream ENSMUSE00000353692 Chr2:142584526..142584645 CGCACCTAATTGGCATTGAT Chr2:142584568..142584587 60.86 45
upstream ENSMUSE00000270731 Chr2:142583633..142583684 CAGACTTACGTCGGCAGAGA Chr2:142583659..142583678 59.19 55
upstream ENSMUSE00000270724 Chr2:142581825..142581962 GGTCCCAATGCTCTGTGAAT Chr2:142581862..142581881 59.93 50
upstream ENSMUSE00000270715 Chr2:142566645..142566727 GAACCAACATGTTCCGCTTT Chr2:142566687..142566706 59.98 45
upstream ENSMUSE00000339473 Chr2:142565259..142565347 TGACCGACCTCTCAAAGTCC Chr2:142565297..142565316 60.24 55
upstream ENSMUSE00000271048 Chr2:142540415..142540468 TGAGAGACAACAGCGTGAAGA Chr2:142540439..142540459 59.76 47.62
upstream ENSMUSE00000557680 Chr2:142537919..142538774 AGAAGTCGGACAAGGCAGAA Chr2:142538726..142538745 59.99 50
upstream ENSMUSE00000271039 Chr2:142537431..142538774 CCAGCTACAGGACCTTCTGC Chr2:142537882..142537901 60.01 60
upstream ENSMUSE00000557678 Chr2:142537431..142537663 CACACCAGTGAATGGTCAGG Chr2:142537485..142537504 60 55
upstream ENSMUSE00000557677 Chr2:142532995..142533147 AGTGGGGGAAACTCTCACCT Chr2:142533016..142533035 59.97 55
upstream ENSMUSE00000389867 Chr2:142529678..142529774 GAAGTCCAGAGACGCCTTCA Chr2:142529733..142529752 60.53 55
upstream ENSMUSE00000710451 Chr2:142528359..142528409 CAATGGCACCACTCAACGTA Chr2:142528373..142528392 60.57 50
upstream ENSMUSE00000715434 Chr2:142528359..142528409 CAATGGCACCACTCAACGTA Chr2:142528373..142528392 60.57 50
upstream ENSMUSE00000682538 Chr2:142516315..142516437 AATCGAGACGACCTGAAGGA Chr2:142516391..142516410 59.8 50
upstream ENSMUSE00000682552 Chr2:142516315..142516437 AATCGAGACGACCTGAAGGA Chr2:142516391..142516410 59.8 50
upstream ENSMUSE00000682537 Chr2:142498025..142498114 ATTCAGGCGCTACAGTCGTT Chr2:142498066..142498085 59.9 50
upstream ENSMUSE00000682549 Chr2:142498025..142498114 ATTCAGGCGCTACAGTCGTT Chr2:142498066..142498085 59.9 50
upstream ENSMUSE00000682534 Chr2:142474164..142474247 GAAACAAAGACGAGCGGGTA Chr2:142474191..142474210 60.25 50
upstream ENSMUSE00000682548 Chr2:142474164..142474247 GAAACAAAGACGAGCGGGTA Chr2:142474191..142474210 60.25 50

*** Putative Vector Insertion (Chr 2: 142474163 - 142498115) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000682532 Chr2:142444081..142445652 ACAGGGTCAGTCCCACTTTG Chr2:142445549..142445568 60 55
downstream ENSMUSE00000682546 Chr2:142444081..142445652 ACAGGGTCAGTCCCACTTTG Chr2:142445549..142445568 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACATAATCGCCTTGCAGCAC Chr2:142489047..142489067 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTAGCTTGCCATTCGTGACT Chr2:142489057..142489078 59.9 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038844