Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32991
Trapped Gene
Dnahc2 (ENSMUSG00000005237)
Vector Insertion
Chr 11: 69234310 - 69234923
Public Clones IST14217E12 (tigm) IST14406E1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 99% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000222015 (Chr11:69234772..69234922 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000222015 (Chr11:69234772..69234922 -)
Downstram Exon
ENSMUSE00000403208 (Chr11:69234311..69234649 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000677512 Chr11:69362494..69362610 No primer for this exon
upstream ENSMUSE00000588643 Chr11:69357879..69358058 No primer for this exon
upstream ENSMUSE00000718811 Chr11:69357879..69358058 No primer for this exon
upstream ENSMUSE00000588642 Chr11:69352900..69353066 No primer for this exon
upstream ENSMUSE00000588641 Chr11:69342885..69343055 No primer for this exon
upstream ENSMUSE00000330726 Chr11:69337676..69337904 No primer for this exon
upstream ENSMUSE00000578754 Chr11:69334592..69334702 No primer for this exon
upstream ENSMUSE00000330707 Chr11:69334214..69334452 No primer for this exon
upstream ENSMUSE00000330698 Chr11:69331778..69331969 No primer for this exon
upstream ENSMUSE00000330690 Chr11:69329977..69330182 No primer for this exon
upstream ENSMUSE00000330681 Chr11:69329484..69329613 No primer for this exon
upstream ENSMUSE00000330671 Chr11:69329123..69329305 No primer for this exon
upstream ENSMUSE00000517521 Chr11:69328178..69328392 No primer for this exon
upstream ENSMUSE00000578752 Chr11:69314214..69314360 No primer for this exon
upstream ENSMUSE00000578751 Chr11:69312607..69312763 No primer for this exon
upstream ENSMUSE00000578750 Chr11:69312014..69312253 No primer for this exon
upstream ENSMUSE00000578749 Chr11:69311316..69311504 No primer for this exon
upstream ENSMUSE00000588640 Chr11:69310011..69310158 No primer for this exon
upstream ENSMUSE00000578747 Chr11:69308574..69308766 No primer for this exon
upstream ENSMUSE00000578746 Chr11:69306607..69306807 No primer for this exon
upstream ENSMUSE00000578745 Chr11:69306158..69306314 No primer for this exon
upstream ENSMUSE00000578744 Chr11:69305622..69305796 No primer for this exon
upstream ENSMUSE00000588639 Chr11:69305005..69305168 No primer for this exon
upstream ENSMUSE00000588638 Chr11:69300674..69300835 No primer for this exon
upstream ENSMUSE00000588637 Chr11:69300461..69300564 No primer for this exon
upstream ENSMUSE00000588636 Chr11:69297695..69297851 No primer for this exon
upstream ENSMUSE00000588635 Chr11:69297486..69297568 No primer for this exon
upstream ENSMUSE00000588634 Chr11:69297197..69297377 No primer for this exon
upstream ENSMUSE00000588633 Chr11:69296740..69296878 No primer for this exon
upstream ENSMUSE00000588632 Chr11:69292947..69293164 No primer for this exon
upstream ENSMUSE00000588631 Chr11:69292225..69292326 No primer for this exon
upstream ENSMUSE00000588630 Chr11:69291527..69291652 No primer for this exon
upstream ENSMUSE00000588629 Chr11:69291165..69291257 No primer for this exon
upstream ENSMUSE00000677511 Chr11:69291147..69291257 No primer for this exon
upstream ENSMUSE00000588628 Chr11:69290662..69290850 No primer for this exon
upstream ENSMUSE00000500623 Chr11:69290118..69290221 No primer for this exon
upstream ENSMUSE00000111832 Chr11:69289830..69290019 No primer for this exon
upstream ENSMUSE00000111831 Chr11:69288968..69289148 No primer for this exon
upstream ENSMUSE00000111835 Chr11:69287702..69287829 No primer for this exon
upstream ENSMUSE00000404935 Chr11:69287222..69287374 No primer for this exon
upstream ENSMUSE00000588627 Chr11:69286854..69286979 No primer for this exon
upstream ENSMUSE00000588626 Chr11:69279083..69279301 No primer for this exon
upstream ENSMUSE00000588625 Chr11:69278774..69278891 No primer for this exon
upstream ENSMUSE00000588624 Chr11:69278422..69278558 No primer for this exon
upstream ENSMUSE00000588623 Chr11:69277065..69277202 No primer for this exon
upstream ENSMUSE00000588622 Chr11:69276818..69276976 No primer for this exon
upstream ENSMUSE00000588621 Chr11:69272650..69272802 No primer for this exon
upstream ENSMUSE00000588620 Chr11:69272368..69272459 No primer for this exon
upstream ENSMUSE00000588619 Chr11:69271862..69272060 No primer for this exon
upstream ENSMUSE00000588618 Chr11:69271488..69271712 No primer for this exon
upstream ENSMUSE00000588617 Chr11:69270843..69270947 No primer for this exon
upstream ENSMUSE00000588616 Chr11:69269293..69269481 No primer for this exon
upstream ENSMUSE00000588615 Chr11:69267830..69267915 No primer for this exon
upstream ENSMUSE00000588614 Chr11:69267564..69267694 No primer for this exon
upstream ENSMUSE00000588613 Chr11:69267278..69267427 No primer for this exon
upstream ENSMUSE00000488785 Chr11:69266663..69266830 No primer for this exon
upstream ENSMUSE00000478728 Chr11:69266320..69266480 No primer for this exon
upstream ENSMUSE00000222215 Chr11:69265909..69266048 No primer for this exon
upstream ENSMUSE00000330911 Chr11:69264724..69264856 No primer for this exon
upstream ENSMUSE00000409016 Chr11:69264501..69264640 No primer for this exon
upstream ENSMUSE00000222065 Chr11:69261894..69262104 No primer for this exon
upstream ENSMUSE00000222206 Chr11:69261616..69261732 No primer for this exon
upstream ENSMUSE00000222200 Chr11:69261298..69261439 No primer for this exon
upstream ENSMUSE00000222055 Chr11:69260077..69260246 No primer for this exon
upstream ENSMUSE00000222050 Chr11:69259781..69259897 No primer for this exon
upstream ENSMUSE00000222180 Chr11:69251299..69251463 No primer for this exon
upstream ENSMUSE00000222171 Chr11:69250673..69250798 No primer for this exon
upstream ENSMUSE00000222392 Chr11:69250424..69250572 No primer for this exon
upstream ENSMUSE00000222386 Chr11:69250283..69250349 No primer for this exon
upstream ENSMUSE00000222380 Chr11:69249986..69250136 No primer for this exon
upstream ENSMUSE00000222371 Chr11:69249640..69249788 No primer for this exon
upstream ENSMUSE00000222491 Chr11:69249335..69249468 No primer for this exon
upstream ENSMUSE00000222486 Chr11:69249056..69249200 No primer for this exon
upstream ENSMUSE00000222480 Chr11:69248706..69248905 No primer for this exon
upstream ENSMUSE00000222475 Chr11:69246356..69246482 No primer for this exon
upstream ENSMUSE00000222470 Chr11:69244561..69244747 No primer for this exon
upstream ENSMUSE00000222463 Chr11:69244252..69244400 No primer for this exon
upstream ENSMUSE00000222460 Chr11:69243976..69244159 No primer for this exon
upstream ENSMUSE00000222458 Chr11:69242804..69242994 No primer for this exon
upstream ENSMUSE00000222453 Chr11:69237366..69237557 No primer for this exon
upstream ENSMUSE00000222450 Chr11:69237009..69237193 No primer for this exon
upstream ENSMUSE00000222444 Chr11:69236483..69236711 No primer for this exon
upstream ENSMUSE00000222435 Chr11:69236258..69236409 No primer for this exon
upstream ENSMUSE00000222427 Chr11:69236021..69236135 No primer for this exon
upstream ENSMUSE00000222366 Chr11:69235232..69235408 No primer for this exon
upstream ENSMUSE00000222026 Chr11:69235064..69235138 No primer for this exon
upstream ENSMUSE00000222015 Chr11:69234772..69234922 No primer for this exon
upstream ENSMUSE00000403208 Chr11:69234311..69234649 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCTCCAGGATGGAGTTTGG Chr11:69234909..69234929 59.65 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCTCCAGGATGGAGTTTGG Chr11:69234909..69234929 59.65 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005237