Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32993
Trapped Gene
Mylk (ENSMUSG00000022836)
Vector Insertion
Chr 16: 34880384 - 34894896
Public Clones IST14369E3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000619474 (Chr16:34880177..34880383 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACAGCATCCAATAGCCTTG Chr16:34880328..34880347 59.3 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000619474 (Chr16:34880177..34880383 +)
Downstram Exon
ENSMUSE00000130981 (Chr16:34894897..34895031 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACAGCATCCAATAGCCTTG Chr16:34880328..34880347 59.3 50 AGCACCGTAGCACAAAATCC Chr16:34894989..34895008 60.14 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000715775 Chr16:34785036..34785113 GAGGGGAACTCGTGTCTCTG Chr16:34785037..34785056 59.83 60
upstream ENSMUSE00000719989 Chr16:34785036..34785113 GAGGGGAACTCGTGTCTCTG Chr16:34785037..34785056 59.83 60
upstream ENSMUSE00000619481 Chr16:34815521..34815688 CCTCTGCGTCAAAGAAGGAG Chr16:34815646..34815665 60.13 55
upstream ENSMUSE00000701172 Chr16:34815521..34815688 CCTCTGCGTCAAAGAAGGAG Chr16:34815646..34815665 60.13 55
upstream ENSMUSE00000619480 Chr16:34860650..34860857 GTGCGGGGGACTTTTAGTCT Chr16:34860737..34860756 60.5 55
upstream ENSMUSE00000701168 Chr16:34860650..34860857 GTGCGGGGGACTTTTAGTCT Chr16:34860737..34860756 60.5 55
upstream ENSMUSE00000619479 Chr16:34873275..34873323 AGCGTGATCAGCCTGTTCTT Chr16:34873290..34873309 60.02 50
upstream ENSMUSE00000701166 Chr16:34873275..34873323 AGCGTGATCAGCCTGTTCTT Chr16:34873290..34873309 60.02 50
upstream ENSMUSE00000619478 Chr16:34874108..34874258 TCCTAGCATCTGGGGTGAGT Chr16:34874126..34874145 59.68 55
upstream ENSMUSE00000701165 Chr16:34874108..34874258 TCCTAGCATCTGGGGTGAGT Chr16:34874126..34874145 59.68 55
upstream ENSMUSE00000619477 Chr16:34875583..34875748 CCCGTGTGTCAATGTCAGAG Chr16:34875608..34875627 60.15 55
upstream ENSMUSE00000701162 Chr16:34875583..34875748 CCCGTGTGTCAATGTCAGAG Chr16:34875608..34875627 60.15 55
upstream ENSMUSE00000644142 Chr16:34878004..34878022 No primer for this exon
upstream ENSMUSE00000701160 Chr16:34878004..34878022 No primer for this exon
upstream ENSMUSE00000619475 Chr16:34879140..34879654 ACCAGCCATAGGGTCCTTCT Chr16:34879425..34879444 59.96 55
upstream ENSMUSE00000701158 Chr16:34879140..34879654 ACCAGCCATAGGGTCCTTCT Chr16:34879425..34879444 59.96 55
upstream ENSMUSE00000619474 Chr16:34880177..34880383 CACAGCATCCAATAGCCTTG Chr16:34880328..34880347 59.3 50
upstream ENSMUSE00000701156 Chr16:34880177..34880383 CACAGCATCCAATAGCCTTG Chr16:34880328..34880347 59.3 50

*** Putative Vector Insertion (Chr 16: 34880384 - 34894896) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000130981 Chr16:34894897..34895031 AGCACCGTAGCACAAAATCC Chr16:34894989..34895008 60.14 50
downstream ENSMUSE00000701154 Chr16:34894897..34895031 AGCACCGTAGCACAAAATCC Chr16:34894989..34895008 60.14 50
downstream ENSMUSE00000130929 Chr16:34899447..34899599 CCTCACAGATGGAGTGAGCA Chr16:34899485..34899504 59.98 55
downstream ENSMUSE00000701151 Chr16:34899447..34899599 CCTCACAGATGGAGTGAGCA Chr16:34899485..34899504 59.98 55
downstream ENSMUSE00000447109 Chr16:34912233..34912370 GACAGACGGTGTTCCCTCTC Chr16:34912272..34912291 59.69 60
downstream ENSMUSE00000447528 Chr16:34912233..34912370 GACAGACGGTGTTCCCTCTC Chr16:34912272..34912291 59.69 60
downstream ENSMUSE00000130965 Chr16:34914050..34914247 CTGCTCGAAGTGGAAGTCCT Chr16:34914129..34914148 59.6 55
downstream ENSMUSE00000130973 Chr16:34914869..34915118 AGAACCAGGGTGAACACGTC Chr16:34915073..34915092 60.01 55
downstream ENSMUSE00000130975 Chr16:34921138..34921209 GAAGGGCTGTTGTGAAGCAT Chr16:34921197..34921216 60.26 50
downstream ENSMUSE00000130952 Chr16:34921659..34922746 GCGAGGACGATGAATTTTGT Chr16:34922741..34922760 60.08 45
downstream ENSMUSE00000447104 Chr16:34921659..34922016 CAGGAGGTCTCGAAAATCCA Chr16:34921902..34921921 60.19 50
downstream ENSMUSE00000223637 Chr16:34929920..34930036 ACTTGGCAGGAACACTCTGC Chr16:34930028..34930047 60.45 55
downstream ENSMUSE00000130949 Chr16:34939012..34939098 GCCTTGGTGTTCTCACTGGT Chr16:34939042..34939061 60.16 55
downstream ENSMUSE00000130985 Chr16:34952865..34952915 CTGCTTTTGTGGGTGTCTTG Chr16:34952918..34952937 59.33 50
downstream ENSMUSE00000701140 Chr16:34953352..34953358 No primer for this exon
downstream ENSMUSE00000130955 Chr16:34953665..34953792 CTGCTTTCGGAACTTCATCC Chr16:34953795..34953814 59.81 50
downstream ENSMUSE00000447098 Chr16:34953853..34954017 CAGTGCTCTCCTCCACTTCC Chr16:34953915..34953934 59.99 60
downstream ENSMUSE00000130944 Chr16:34956469..34956622 CCTTGATATGCTCGCTCTCC Chr16:34956496..34956515 59.94 55
downstream ENSMUSE00000223609 Chr16:34963630..34963932 AATTTGTACTCGCGGTCAGG Chr16:34963852..34963871 60.13 50
downstream ENSMUSE00000223603 Chr16:34971328..34971360 CATCGGACACTTCCACTTCA Chr16:34971360..34971379 59.68 50
downstream ENSMUSE00000223598 Chr16:34971460..34971553 CGTCCGGTAATCAACCTCAG Chr16:34971494..34971513 60.51 55
downstream ENSMUSE00000394896 Chr16:34971905..34972108 TTTTCTTCGAAGGCATCCAC Chr16:34972084..34972103 60.19 45
downstream ENSMUSE00000337291 Chr16:34976971..34977188 CCTCGTCAATGATACGCTCA Chr16:34977014..34977033 59.82 50
downstream ENSMUSE00000385997 Chr16:34979258..34979381 CCGATGGGCTCATAGTTGAT Chr16:34979339..34979358 59.92 50
downstream ENSMUSE00000412139 Chr16:34986527..34986679 GATCTCATCGAATGCCTCGT Chr16:34986632..34986651 60.19 50
downstream ENSMUSE00000367117 Chr16:34988968..34989091 CCACTTCCTTCTTGCCATGT Chr16:34989091..34989110 60.11 50
downstream ENSMUSE00000404670 Chr16:34995160..34995289 AGTTTCTCCGCATTGATTGG Chr16:34995281..34995300 60.07 45
downstream ENSMUSE00000223556 Chr16:34996811..34996942 CTTCCAGATCACGGATGGTC Chr16:34996903..34996922 60.47 55
downstream ENSMUSE00000619473 Chr16:35000359..35002520 CTACCACACCAGGTGCCTTT Chr16:35000741..35000760 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATGCCTTTAATCGCCTTGC Chr16:34889427..34889447 60.19 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGGCAGCGATGACTCTACC Chr16:34892353..34892373 60.25 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022836