Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33004
Trapped Gene
A130090K04Rik (ENSMUSG00000064065)
Vector Insertion
Chr 10: 3350012 - 3366164
Public Clones IST14976G1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000645105 (Chr10:3349965..3350011 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTATGGCCACAGAAGGCAAT Chr10:3349992..3350011 60.47 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000645105 (Chr10:3349965..3350011 +)
Downstram Exon
ENSMUSE00000666881 (Chr10:3366165..3366294 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTATGGCCACAGAAGGCAAT Chr10:3349992..3350011 60.47 45 TTTTCTTCCTGGGCTTCTGA Chr10:3366291..3366310 59.93 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000645108 Chr10:3294060..3294084 No primer for this exon
upstream ENSMUSE00000645107 Chr10:3323356..3323399 TCAGCAGCAGTAGACCTGGA Chr10:3323357..3323376 59.73 55
upstream ENSMUSE00000645105 Chr10:3349965..3350011 TTATGGCCACAGAAGGCAAT Chr10:3349992..3350011 60.47 45

*** Putative Vector Insertion (Chr 10: 3350012 - 3366164) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000645102 Chr10:3366076..3366294 GCAGAGCTCAAGGGAAGCTA Chr10:3366125..3366144 59.86 55
downstream ENSMUSE00000666881 Chr10:3366165..3366294 TTTTCTTCCTGGGCTTCTGA Chr10:3366291..3366310 59.93 45
downstream ENSMUSE00000616800 Chr10:3366830..3367027 GTTGCATGGACAGGTGAGTG Chr10:3366852..3366871 60.16 55
downstream ENSMUSE00000645101 Chr10:3366858..3367027 GCACCACCCAGAACTTTTTC Chr10:3366992..3367011 59.57 50
downstream ENSMUSE00000666880 Chr10:3366858..3367027 GCACCACCCAGAACTTTTTC Chr10:3366992..3367011 59.57 50
downstream ENSMUSE00000616799 Chr10:3390409..3390482 TGCATTCAGAGGCTCTTTCC Chr10:3390475..3390494 60.48 50
downstream ENSMUSE00000616798 Chr10:3391800..3391871 GGCTTTGATCTGTGGGTGAT Chr10:3391836..3391855 59.93 50
downstream ENSMUSE00000616797 Chr10:3409382..3409440 TTTGTGATGGATTCCTGGTG Chr10:3409435..3409454 59.34 45
downstream ENSMUSE00000616796 Chr10:3411266..3411366 AGGATCTTCCTGCTCGCTCT Chr10:3411300..3411319 60.64 55
downstream ENSMUSE00000645104 Chr10:3411266..3411354 AGGATCTTCCTGCTCGCTCT Chr10:3411300..3411319 60.64 55
downstream ENSMUSE00000489071 Chr10:3426455..3426827 GTGCCAGGACTGTCGTTCTT Chr10:3426589..3426608 60.31 55
downstream ENSMUSE00000645100 Chr10:3426455..3428987 GGCTTTCGAATGAAAAGCAG Chr10:3428289..3428308 59.96 45
downstream ENSMUSE00000645103 Chr10:3434583..3434998 GTGGCTCAGAGACGGGTAAC Chr10:3434874..3434893 59.73 60
downstream ENSMUSE00000323581 Chr10:3445778..3445971 TGCATCGCTTCACAAAAGAC Chr10:3445915..3445934 59.99 45
downstream ENSMUSE00000616795 Chr10:3455866..3456102 AGCCAAATCGTGTTCTTTGC Chr10:3455889..3455908 60.26 45
downstream ENSMUSE00000666879 Chr10:3455866..3460745 CAGGACAGTTCGCATCTCAA Chr10:3459788..3459807 59.98 50
downstream ENSMUSE00000666882 Chr10:3455866..3460176 CAGGACAGTTCGCATCTCAA Chr10:3459788..3459807 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTATGGCCACAGAAGGCAAT Chr10:3361993..3362013 60.47 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTATGGCCACAGAAGGCAAT Chr10:3361993..3362013 60.47 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000064065