Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33005
Trapped Gene
Tmlhe (ENSMUSG00000079834)
Vector Insertion
Chr NT_165789: 258424 - 272713
Public Clones IST13879H11 (tigm) IST14976G1 (tigm) IST10605F5 (tigm) IST11182E6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 28% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000704943 (ChrNT_165789:258247..258423 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACTGTGATGCGCTTTGATT ChrNT_165789:258263..258282 59.87 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000704943 (ChrNT_165789:258247..258423 +)
Downstram Exon
ENSMUSE00000704940 (ChrNT_165789:272714..272993 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACTGTGATGCGCTTTGATT ChrNT_165789:258263..258282 59.87 45 TCAGTGGGAGGGACATTTTC ChrNT_165789:272954..272973 59.9 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000704952 ChrNT_165789:159647..159773 CTGACAAAGCGGCACTACAG ChrNT_165789:159698..159717 59.66 55
upstream ENSMUSE00000704951 ChrNT_165789:216736..216917 AAGCAGGCTCCGTAATTTGA ChrNT_165789:216766..216785 59.85 45
upstream ENSMUSE00000704943 ChrNT_165789:258247..258423 CACTGTGATGCGCTTTGATT ChrNT_165789:258263..258282 59.87 45

*** Putative Vector Insertion (Chr NT_165789: 258424 - 272713) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000704940 ChrNT_165789:272714..272993 TCAGTGGGAGGGACATTTTC ChrNT_165789:272954..272973 59.9 50
downstream ENSMUSE00000704936 ChrNT_165789:285396..285515 ATGCAGTGTCACCTCTGGAA ChrNT_165789:285460..285479 59.26 50
downstream ENSMUSE00000704934 ChrNT_165789:326114..326350 ACCACCTGTTCCTTCATGCT ChrNT_165789:326159..326178 59.58 50
downstream ENSMUSE00000704928 ChrNT_165789:332450..332588 GTTAGGGTTCGGTGTGCTGT ChrNT_165789:332536..332555 60.03 55
downstream ENSMUSE00000704922 ChrNT_165789:333195..334143 CAGCCACAGAGTTGACGGTA ChrNT_165789:333271..333290 59.9 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCATTCTGGATAATCGCCTTG ChrNT_165789:264465..264486 60.04 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGGACGTGACTGGGAAAAC ChrNT_165789:264470..264490 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079834