Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33012
Trapped Gene
Insr (ENSMUSG00000005534)
Vector Insertion
Chr 8: 3167501 - 3169869
Public Clones IST11731B9 (tigm) IST14606C10 (tigm) IST11681G11 (tigm) IST11449C12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 68% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000611280 (Chr8:3169709..3169868 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000611280 (Chr8:3169709..3169868 -)
Downstram Exon
ENSMUSE00000611279 (Chr8:3167502..3167604 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000638456 Chr8:3279029..3279128 No primer for this exon
upstream ENSMUSE00000611295 Chr8:3258383..3258934 No primer for this exon
upstream ENSMUSE00000611294 Chr8:3211379..3211700 No primer for this exon
upstream ENSMUSE00000611293 Chr8:3204630..3204778 No primer for this exon
upstream ENSMUSE00000611267 Chr8:3202890..3203034 No primer for this exon
upstream ENSMUSE00000638453 Chr8:3198061..3198275 No primer for this exon
upstream ENSMUSE00000611287 Chr8:3194795..3194921 No primer for this exon
upstream ENSMUSE00000611286 Chr8:3192546..3192802 No primer for this exon
upstream ENSMUSE00000611285 Chr8:3189125..3189292 No primer for this exon
upstream ENSMUSE00000611282 Chr8:3184951..3185152 No primer for this exon
upstream ENSMUSE00000233977 Chr8:3174614..3174888 No primer for this exon
upstream ENSMUSE00000233970 Chr8:3173480..3173619 No primer for this exon
upstream ENSMUSE00000611280 Chr8:3169709..3169868 No primer for this exon
upstream ENSMUSE00000611279 Chr8:3167502..3167604 No primer for this exon

*** Putative Vector Insertion (Chr 8: 3167501 - 3169869) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000611278 Chr8:3165518..3165585 No primer for this exon
downstream ENSMUSE00000611277 Chr8:3163237..3163481 No primer for this exon
downstream ENSMUSE00000611276 Chr8:3161681..3161791 No primer for this exon
downstream ENSMUSE00000611274 Chr8:3161339..3161498 No primer for this exon
downstream ENSMUSE00000611273 Chr8:3159453..3159582 No primer for this exon
downstream ENSMUSE00000611272 Chr8:3158696..3158830 No primer for this exon
downstream ENSMUSE00000569243 Chr8:3155401..3156023 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGCTGCACCTCTGTGTCT Chr8:3169848..3169868 60.62 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGCTGCACCTCTGTGTCT Chr8:3169848..3169868 60.62 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005534