Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33039
Trapped Gene
Rps9 (ENSMUSG00000006333)
Vector Insertion
Chr 7: 3656051 - 3656247
Public Clones IST14415F4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 23% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000344165 (Chr7:3655929..3656050 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000344165 (Chr7:3655929..3656050 +)
Downstram Exon
ENSMUSE00000134589 (Chr7:3656248..3656370 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000435325 Chr7:3655640..3655666 No primer for this exon
upstream ENSMUSE00000677413 Chr7:3655654..3656050 No primer for this exon
upstream ENSMUSE00000677411 Chr7:3655922..3656050 No primer for this exon
upstream ENSMUSE00000344165 Chr7:3655929..3656050 No primer for this exon
upstream ENSMUSE00000719145 Chr7:3655929..3656050 No primer for this exon

*** Putative Vector Insertion (Chr 7: 3656051 - 3656247) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000134589 Chr7:3656248..3656370 No primer for this exon
downstream ENSMUSE00000134587 Chr7:3657335..3657521 No primer for this exon
downstream ENSMUSE00000677409 Chr7:3657610..3658497 No primer for this exon
downstream ENSMUSE00000413884 Chr7:3658253..3658499 No primer for this exon
downstream ENSMUSE00000677410 Chr7:3658253..3658478 No primer for this exon
downstream ENSMUSE00000677412 Chr7:3658253..3658459 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGTCTCGACCAGGAGCTAAA Chr7:3656024..3656044 60.53 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGTCTCGACCAGGAGCTAAA Chr7:3656024..3656044 60.53 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000006333