Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33040
Trapped Gene
Mcf2l (ENSMUSG00000031442)
Vector Insertion
Chr 8: 12926734 - 12947952
Public Clones IST14961A9 (tigm) IST12991E5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000685736 (Chr8:12926632..12926733 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCGGTTCTGGTCACTATCAAG Chr8:12926678..12926698 59.75 52.38 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000685736 (Chr8:12926632..12926733 +)
Downstram Exon
ENSMUSE00000685728 (Chr8:12947953..12948186 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCGGTTCTGGTCACTATCAAG Chr8:12926678..12926698 59.75 52.38 TGAGGCTCAAAGTCATGCTG Chr8:12948132..12948151 60.14 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000685780 Chr8:12873827..12874016 GAGAAGACAGTCCCCAGCAC Chr8:12873991..12874010 59.84 60
upstream ENSMUSE00000610323 Chr8:12879882..12880150 TTGTCCGAAGAAGCAATCCT Chr8:12879918..12879937 59.81 45
upstream ENSMUSE00000685753 Chr8:12915331..12915495 CACCGTCTCCCTCTTACCTG Chr8:12915406..12915425 59.72 60
upstream ENSMUSE00000512174 Chr8:12915930..12916054 GAGATTAAACGCGGTTTCCA Chr8:12916026..12916045 60.07 45
upstream ENSMUSE00000720375 Chr8:12915930..12916054 GAGATTAAACGCGGTTTCCA Chr8:12916026..12916045 60.07 45
upstream ENSMUSE00000708181 Chr8:12915958..12916054 GAGATTAAACGCGGTTTCCA Chr8:12916026..12916045 60.07 45
upstream ENSMUSE00000717464 Chr8:12915958..12916054 GAGATTAAACGCGGTTTCCA Chr8:12916026..12916045 60.07 45
upstream ENSMUSE00000685736 Chr8:12926632..12926733 GCGGTTCTGGTCACTATCAAG Chr8:12926678..12926698 59.75 52.38

*** Putative Vector Insertion (Chr 8: 12926734 - 12947952) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000685732 Chr8:12947780..12948186 TGAGGCTCAAAGTCATGCTG Chr8:12948132..12948151 60.14 50
downstream ENSMUSE00000685728 Chr8:12947953..12948186 TGAGGCTCAAAGTCATGCTG Chr8:12948132..12948151 60.14 50
downstream ENSMUSE00000685721 Chr8:12949459..12949676 AGATAGGCTTGAGCCGAGTG Chr8:12949659..12949678 59.6 55
downstream ENSMUSE00000685720 Chr8:12949486..12949676 AGATAGGCTTGAGCCGAGTG Chr8:12949659..12949678 59.6 55
downstream ENSMUSE00000685718 Chr8:12963136..12963247 ATTTCATCTGCAGGGAGAGC Chr8:12963173..12963192 59.39 50
downstream ENSMUSE00000523464 Chr8:12963164..12963247 CTTCAGCTGCTCCTGGATGT Chr8:12963228..12963247 60.56 55
downstream ENSMUSE00000685710 Chr8:12963164..12963247 CTTCAGCTGCTCCTGGATGT Chr8:12963228..12963247 60.56 55
downstream ENSMUSE00000421568 Chr8:12972979..12973093 GAACTCCTTGTCCGGGATCT Chr8:12973061..12973080 60.46 55
downstream ENSMUSE00000685709 Chr8:12972979..12973093 GAACTCCTTGTCCGGGATCT Chr8:12973061..12973080 60.46 55
downstream ENSMUSE00000685715 Chr8:12984296..12984950 TTCGGGTGAAAATCTCCAAG Chr8:12984445..12984464 60.04 45
downstream ENSMUSE00000209534 Chr8:12984860..12984950 TTGTCCTGCCTTCGGTCTAT Chr8:12984916..12984935 59.69 50
downstream ENSMUSE00000638151 Chr8:12984860..12984950 TTGTCCTGCCTTCGGTCTAT Chr8:12984916..12984935 59.69 50
downstream ENSMUSE00000421377 Chr8:12991645..12991725 CCAAACTGGAGAGACGTTGC Chr8:12991686..12991705 60.83 55
downstream ENSMUSE00000209531 Chr8:12993829..12993948 GAAGGCAATGTCCGAGAGAG Chr8:12993915..12993934 59.95 55
downstream ENSMUSE00000685708 Chr8:12993829..12993948 GAAGGCAATGTCCGAGAGAG Chr8:12993915..12993934 59.95 55
downstream ENSMUSE00000209536 Chr8:12996610..12996726 CTCGGTCAGCTGCGACTTAT Chr8:12996675..12996694 60.56 55
downstream ENSMUSE00000685707 Chr8:12996610..12996726 CTCGGTCAGCTGCGACTTAT Chr8:12996675..12996694 60.56 55
downstream ENSMUSE00000209541 Chr8:12997246..12997395 GTCATTCGGCAGCTCTGTTT Chr8:12997341..12997360 60.41 50
downstream ENSMUSE00000685705 Chr8:12997246..12997395 GTCATTCGGCAGCTCTGTTT Chr8:12997341..12997360 60.41 50
downstream ENSMUSE00000209533 Chr8:12998369..12998493 GTTCCCCTCCTTCAGTGCTA Chr8:12998404..12998423 59.28 55
downstream ENSMUSE00000274614 Chr8:12999949..13000063 AGGCACTGTTCCAGCTTCTG Chr8:13000032..13000051 60.59 55
downstream ENSMUSE00000274608 Chr8:13000743..13000862 TGGAATCCAAGGTGGTTTTG Chr8:13000767..13000786 60.72 45
downstream ENSMUSE00000274601 Chr8:13001282..13001473 CAGCGTAGTGCCTGTTCTCA Chr8:13001354..13001373 60.2 55
downstream ENSMUSE00000421478 Chr8:13001811..13002002 TATTTTCTGCACCGGTCTCC Chr8:13001943..13001962 60.07 50
downstream ENSMUSE00000209528 Chr8:13002638..13002797 CTCCGTGCTTTCTTGCTTCT Chr8:13002682..13002701 59.76 50
downstream ENSMUSE00000209546 Chr8:13003575..13003648 GTTGCCCTCAGAGCTGGAGT Chr8:13003618..13003637 61.92 60
downstream ENSMUSE00000209535 Chr8:13003885..13003961 No primer for this exon
downstream ENSMUSE00000209525 Chr8:13005450..13005516 CTCGGTGTCCAGAAGCTCAT Chr8:13005483..13005502 60.41 55
downstream ENSMUSE00000209529 Chr8:13006725..13006840 GTGTGCCATCAAGGGGTTAT Chr8:13006766..13006785 59.68 50
downstream ENSMUSE00000685717 Chr8:13006725..13006841 GTGTGCCATCAAGGGGTTAT Chr8:13006766..13006785 59.68 50
downstream ENSMUSE00000209542 Chr8:13007685..13007754 GGGCAGTCTATGCAGCTCTC Chr8:13007726..13007745 60.13 60
downstream ENSMUSE00000638155 Chr8:13007685..13007699 No primer for this exon
downstream ENSMUSE00000638154 Chr8:13007704..13007754 GGGCAGTCTATGCAGCTCTC Chr8:13007726..13007745 60.13 60
downstream ENSMUSE00000209524 Chr8:13009467..13009559 AGAGCGTGGCTTGTTCTGAC Chr8:13009520..13009539 60.6 55
downstream ENSMUSE00000209548 Chr8:13009654..13009746 GCTTGTGGTCCAGCTTCTTC Chr8:13009684..13009703 60 55
downstream ENSMUSE00000209527 Chr8:13010416..13010541 TGAGATGCATGGAGTCGTTC Chr8:13010524..13010543 59.79 50
downstream ENSMUSE00000274560 Chr8:13011379..13011600 TTCTCGTGCAGAAACAGGTG Chr8:13011518..13011537 60.03 50
downstream ENSMUSE00000274555 Chr8:13011729..13011821 TCCCTTGCGTTGTACCAGAT Chr8:13011805..13011824 60.52 50
downstream ENSMUSE00000274550 Chr8:13012801..13012879 GTCAGCACCTTCCGAATCTC Chr8:13012859..13012878 59.81 55
downstream ENSMUSE00000274546 Chr8:13012998..13013064 AAAGGAAGGCTGTGGGACTG Chr8:13013046..13013065 61.58 55
downstream ENSMUSE00000274541 Chr8:13013535..13013650 CGGTCTTCGAGCTTCTTGAC Chr8:13013582..13013601 60.13 55
downstream ENSMUSE00000685726 Chr8:13013737..13014029 ACTAGGGACCGCATCGTCTA Chr8:13013934..13013953 59.72 55
downstream ENSMUSE00000487495 Chr8:13013915..13014007 TAGAACTAGGGACCGCATCG Chr8:13013938..13013957 60.23 55
downstream ENSMUSE00000411213 Chr8:13014819..13014893 GGGTCGCTCTTTACTTCGTG Chr8:13014876..13014895 59.88 55
downstream ENSMUSE00000274533 Chr8:13017347..13017468 AGTGGGATGTTTTGCTCCAG Chr8:13017370..13017389 60.11 50
downstream ENSMUSE00000421402 Chr8:13018061..13018173 CCACCTCCACCATATCTCCA Chr8:13018151..13018170 60.74 55
downstream ENSMUSE00000685752 Chr8:13018061..13018177 CCACCTCCACCATATCTCCA Chr8:13018151..13018170 60.74 55
downstream ENSMUSE00000638148 Chr8:13018696..13018799 ACTGGGCTGAACTGGATTTG Chr8:13018787..13018806 60.11 50
downstream ENSMUSE00000685719 Chr8:13018696..13020499 CAGCAGCGTGAGACCATAAA Chr8:13020326..13020345 60.01 50
downstream ENSMUSE00000685741 Chr8:13018696..13020478 CAGCAGCGTGAGACCATAAA Chr8:13020326..13020345 60.01 50
downstream ENSMUSE00000685746 Chr8:13018696..13020509 CAGCAGCGTGAGACCATAAA Chr8:13020326..13020345 60.01 50
downstream ENSMUSE00000685754 Chr8:13018696..13019053 CTGCTTTTAAACGGGCTCTG Chr8:13018876..13018895 60.01 50
downstream ENSMUSE00000718845 Chr8:13018696..13018867 GCGCACAGTGGATCTTACCT Chr8:13018820..13018839 60.28 55
downstream ENSMUSE00000720662 Chr8:13018696..13018867 GCGCACAGTGGATCTTACCT Chr8:13018820..13018839 60.28 55
downstream ENSMUSE00000638145 Chr8:13018886..13019275 TTTGCATGCTGGTCTACTGC Chr8:13019084..13019103 60.02 50
downstream ENSMUSE00000685714 Chr8:13018939..13020505 CAGCAGCGTGAGACCATAAA Chr8:13020326..13020345 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGTGCTCTAATCGCCTTGC Chr8:12932777..12932797 60.12 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTCTCGTGACTGGGAAAAC Chr8:12932780..12932800 59.85 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031442