Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33054
Trapped Gene
Supt7l (ENSMUSG00000053134)
Vector Insertion
Chr 5: 31827557 - 31829080
Public Clones (sanger) IST14620C4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000601235 (Chr5:31828988..31829079 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TAGTCCTCGACTCCGACCTG Chr5:31829030..31829049 60.4 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000601235 (Chr5:31828988..31829079 -)
Downstram Exon
ENSMUSE00000716985 (Chr5:31827558..31827641 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TAGTCCTCGACTCCGACCTG Chr5:31829030..31829049 60.4 60 TCCTCAGGTCCAACAAACATC Chr5:31827562..31827582 59.96 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000601235 Chr5:31828988..31829079 TAGTCCTCGACTCCGACCTG Chr5:31829030..31829049 60.4 60
upstream ENSMUSE00000712125 Chr5:31828988..31829109 TAGTCCTCGACTCCGACCTG Chr5:31829030..31829049 60.4 60
upstream ENSMUSE00000716742 Chr5:31828988..31829104 TAGTCCTCGACTCCGACCTG Chr5:31829030..31829049 60.4 60
upstream ENSMUSE00000716985 Chr5:31827558..31827641 GATGTTTGTTGGACCTGAGGA Chr5:31827584..31827604 59.96 47.62

*** Putative Vector Insertion (Chr 5: 31827557 - 31829080) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000517139 Chr5:31825027..31825634 ATGGTGAGGCTACACGGTTC Chr5:31825233..31825252 60 55
downstream ENSMUSE00000715678 Chr5:31825027..31825431 ATGGTGAGGCTACACGGTTC Chr5:31825233..31825252 60 55
downstream ENSMUSE00000719383 Chr5:31825027..31825634 ATGGTGAGGCTACACGGTTC Chr5:31825233..31825252 60 55
downstream ENSMUSE00000721760 Chr5:31825027..31825532 ATGGTGAGGCTACACGGTTC Chr5:31825233..31825252 60 55
downstream ENSMUSE00000515370 Chr5:31822456..31822780 TTGTGGCGACTGCTTGATAG Chr5:31822685..31822704 60.01 50
downstream ENSMUSE00000444537 Chr5:31820640..31820877 AATGTGATGTCGCTCACAGG Chr5:31820746..31820765 59.71 50
downstream ENSMUSE00000720163 Chr5:31818872..31820877 GAACACACATGCCACGTTTC Chr5:31819459..31819478 60.02 50
downstream ENSMUSE00000713407 Chr5:31817695..31818299 CAGAAACGACGCAAAGTGAA Chr5:31817896..31817915 60.03 45
downstream ENSMUSE00000654693 Chr5:31816952..31818299 CAGAAACGACGCAAAGTGAA Chr5:31817896..31817915 60.03 45
downstream ENSMUSE00000716321 Chr5:31816943..31818299 CAGAAACGACGCAAAGTGAA Chr5:31817896..31817915 60.03 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCGACTCCGACCTTAATCG Chr5:31829023..31829043 59.83 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAGTCCTCGACTCCGACCTC Chr5:31829028..31829048 59.4 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053134