Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33057
Trapped Gene
2310057J16Rik (ENSMUSG00000044433)
Vector Insertion
Chr 8: 3600815 - 3601965
Public Clones IST14465A1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000413235 (Chr8:3600676..3600814 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGCCACCATCCACTGCTAT Chr8:3600770..3600789 61.09 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000413235 (Chr8:3600676..3600814 +)
Downstram Exon
ENSMUSE00000367515 (Chr8:3601966..3602105 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGCCACCATCCACTGCTAT Chr8:3600770..3600789 61.09 55 GCACCAGCTGGAGGTTGTAT Chr8:3602028..3602047 60.14 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000611125 Chr8:3587676..3587959 TCCCCGAGATCAAGTCTTTG Chr8:3587864..3587883 60.19 50
upstream ENSMUSE00000362556 Chr8:3597842..3598095 GATCAGTACGCACAGGAGCA Chr8:3597880..3597899 60.02 55
upstream ENSMUSE00000400943 Chr8:3598686..3598808 AGCTGTCATCGATGCTCTCA Chr8:3598697..3598716 59.69 50
upstream ENSMUSE00000426516 Chr8:3598893..3598988 TGCAGGAGAAGACAGAACAAGA Chr8:3598906..3598927 60.17 45.46
upstream ENSMUSE00000413235 Chr8:3600676..3600814 CTGCCACCATCCACTGCTAT Chr8:3600770..3600789 61.09 55

*** Putative Vector Insertion (Chr 8: 3600815 - 3601965) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000367515 Chr8:3601966..3602105 GCACCAGCTGGAGGTTGTAT Chr8:3602028..3602047 60.14 55
downstream ENSMUSE00000364692 Chr8:3602186..3602279 TGCACAAAATCAGGCTTCAG Chr8:3602256..3602275 59.99 45
downstream ENSMUSE00000426501 Chr8:3602371..3602425 CTGCTGCCACTGTTGTTCTG Chr8:3602428..3602447 60.65 55
downstream ENSMUSE00000426499 Chr8:3602554..3602627 GATCCTCGGAGTGGAGACTG Chr8:3602625..3602644 59.79 60
downstream ENSMUSE00000408211 Chr8:3603432..3603501 TCCATGTGAGACATTGATGGA Chr8:3603470..3603490 59.91 42.86
downstream ENSMUSE00000369212 Chr8:3603606..3605076 ATGTTGACACAGGACGTGGA Chr8:3603745..3603764 60.01 50
downstream ENSMUSE00000369927 Chr8:3606267..3606406 CCGTTTCTGCTCCTTCTCTG Chr8:3606395..3606414 60.13 55
downstream ENSMUSE00000411628 Chr8:3606504..3606820 CCGGCGTTCATACTCAAGTC Chr8:3606666..3606685 60.66 55
downstream ENSMUSE00000686571 Chr8:3606504..3606823 CCGGCGTTCATACTCAAGTC Chr8:3606666..3606685 60.66 55
downstream ENSMUSE00000232670 Chr8:3607791..3607890 AAGGTTATTGGGAGCCTCGT Chr8:3607870..3607889 59.96 50
downstream ENSMUSE00000210025 Chr8:3608189..3608301 TCCATTCTCCCAGTCACGTT Chr8:3608264..3608283 60.51 50
downstream ENSMUSE00000210021 Chr8:3608394..3608512 GTTCTTCTGGGGCTCATTCA Chr8:3608503..3608522 60.19 50
downstream ENSMUSE00000375938 Chr8:3608598..3609047 TGGTTTTAGCAGGGATCTGG Chr8:3608811..3608830 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000044433