Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33067
Trapped Gene
1600012H06Rik (ENSMUSG00000050088)
Vector Insertion
Chr 17: 15080325 - 15080571
Public Clones IST14401H12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000482194 (Chr17:15080189..15080324 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCCGGAGTACCACACTTCC Chr17:15080219..15080238 59.97 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000482194 (Chr17:15080189..15080324 +)
Downstram Exon
ENSMUSE00000482932 (Chr17:15080572..15082941 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCCGGAGTACCACACTTCC Chr17:15080219..15080238 59.97 55 TCAAAGTCGCTCTCATGGTG Chr17:15080991..15081010 59.98 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000482194 Chr17:15080189..15080324 TTCCGGAGTACCACACTTCC Chr17:15080219..15080238 59.97 55

*** Putative Vector Insertion (Chr 17: 15080325 - 15080571) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000482932 Chr17:15080572..15082941 TCAAAGTCGCTCTCATGGTG Chr17:15080991..15081010 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTGGCGACCTCGCTATTCT Chr17:15080337..15080357 61.66 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTGGCGACCTCGCTATTCT Chr17:15080337..15080357 61.66 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000050088