Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33069
Trapped Gene
Mtmr7 (ENSMUSG00000039431)
Vector Insertion
Chr 8: 41666767 - 41672537
Public Clones IST10669D7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 52% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000221643 (Chr8:41672402..41672536 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAAGCCAATCCTGGAAGTGA Chr8:41672433..41672452 59.67 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000221643 (Chr8:41672402..41672536 -)
Downstram Exon
ENSMUSE00000221638 (Chr8:41666768..41666900 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAAGCCAATCCTGGAAGTGA Chr8:41672433..41672452 59.67 45 TCCTCATGACGTGGATGTTC Chr8:41666770..41666789 59.48 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000684024 Chr8:41720052..41720110 No primer for this exon
upstream ENSMUSE00000339782 Chr8:41694248..41694370 TGTATCTGACGGCCACTCAC Chr8:41694293..41694312 59.71 55
upstream ENSMUSE00000221657 Chr8:41692113..41692275 TCTGCTTATTCGCTGCAAGA Chr8:41692197..41692216 59.86 45
upstream ENSMUSE00000221652 Chr8:41682637..41682794 GCAGCTCAGCGATGTGAATA Chr8:41682648..41682667 60.13 50
upstream ENSMUSE00000221646 Chr8:41675764..41675892 AACTGTACGTCCCCAGATCG Chr8:41675851..41675870 59.99 55
upstream ENSMUSE00000221643 Chr8:41672402..41672536 AAAGCCAATCCTGGAAGTGA Chr8:41672433..41672452 59.67 45
upstream ENSMUSE00000221638 Chr8:41666768..41666900 CATCCACGTCATGAGGAACA Chr8:41666789..41666808 60.53 50

*** Putative Vector Insertion (Chr 8: 41666767 - 41672537) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000221630 Chr8:41649314..41649423 CAGTCCCCACAGGAAATCAC Chr8:41649355..41649374 60.36 55
downstream ENSMUSE00000221690 Chr8:41647924..41648049 CGGTAGTAAGGGTCCAGCAG Chr8:41647921..41647940 59.75 60
downstream ENSMUSE00000221682 Chr8:41646211..41646260 TGTCCGAAGGAAATCCAGTC Chr8:41646204..41646223 60.05 50
downstream ENSMUSE00000221679 Chr8:41643510..41643710 TGAGTTCTCGCCTCTCCTTC Chr8:41643489..41643508 59.68 55
downstream ENSMUSE00000341869 Chr8:41641835..41641886 AAGGAACCGTGAACCCTTTT Chr8:41641828..41641847 59.84 45
downstream ENSMUSE00000582464 Chr8:41641130..41641270 GCATGGAGCTGTAGGCAGAT Chr8:41641122..41641141 60.39 55
downstream ENSMUSE00000221672 Chr8:41639625..41639751 CCCCTTTTCAAAGCGGTTAT Chr8:41639693..41639712 60.31 45
downstream ENSMUSE00000637227 Chr8:41636455..41637267 GCTGGGCTCACTTTGCTTAC Chr8:41637177..41637196 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTGTGTTGCTGTGGCCTCT Chr8:41669543..41669563 62.04 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTGTGTTGCTGTGGCCTCT Chr8:41669543..41669563 62.04 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039431