Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33074
Trapped Gene
Tbcd (ENSMUSG00000039230)
Vector Insertion
Chr 11: 121365102 - 121402165
Public Clones IST13000H5 (tigm) IST10985G10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 37% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000668562 (Chr11:121365007..121365101 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTGGCAGAGCTGGGTAGAC Chr11:121365049..121365068 59.31 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000668562 (Chr11:121365007..121365101 +)
Downstram Exon
ENSMUSE00000306479 (Chr11:121402166..121402322 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTGGCAGAGCTGGGTAGAC Chr11:121365049..121365068 59.31 55 CCCGCTTCTCATCGTAGGTA Chr11:121402213..121402232 60.23 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000661024 Chr11:121313261..121313542 CTGGCAGTTCTCGTGCTGTA Chr11:121313288..121313307 60.2 55
upstream ENSMUSE00000306554 Chr11:121314945..121314995 No primer for this exon
upstream ENSMUSE00000306549 Chr11:121320715..121320812 TTGGACCTGGTACAGGATGAG Chr11:121320735..121320755 59.97 52.38
upstream ENSMUSE00000379985 Chr11:121321723..121321824 TGGCTAATGTTCAGCCTGTG Chr11:121321766..121321785 59.86 50
upstream ENSMUSE00000389426 Chr11:121322568..121322714 ACCTGCTTGATCCCTTTTGA Chr11:121322610..121322629 59.67 45
upstream ENSMUSE00000347341 Chr11:121323066..121323121 CTTGGTGGTCAGTGACAAGG Chr11:121323071..121323090 59.15 55
upstream ENSMUSE00000306529 Chr11:121336853..121336985 CCATCGAGGGTGTCATTACC Chr11:121336942..121336961 60.19 55
upstream ENSMUSE00000668571 Chr11:121349635..121349766 CTCTGGATTCCTGCAAGAGG Chr11:121349672..121349691 59.94 55
upstream ENSMUSE00000668569 Chr11:121349749..121349766 No primer for this exon
upstream ENSMUSE00000306522 Chr11:121353872..121353917 CGTGAAGACTGCCTTCCCTA Chr11:121353896..121353915 60.39 55
upstream ENSMUSE00000382257 Chr11:121355073..121355205 CCCGAGAGCAGTCATACCTC Chr11:121355111..121355130 59.83 60
upstream ENSMUSE00000668570 Chr11:121358309..121358365 GTCGGTCTTTGGCTGCTAAC Chr11:121358323..121358342 59.88 55
upstream ENSMUSE00000710685 Chr11:121358309..121358451 GTCGGTCTTTGGCTGCTAAC Chr11:121358323..121358342 59.88 55
upstream ENSMUSE00000712630 Chr11:121358309..121358451 GTCGGTCTTTGGCTGCTAAC Chr11:121358323..121358342 59.88 55
upstream ENSMUSE00000306499 Chr11:121360350..121360410 GCTACTGGTTGGGTTGAAGG Chr11:121360354..121360373 59.59 55
upstream ENSMUSE00000668564 Chr11:121360350..121360410 GCTACTGGTTGGGTTGAAGG Chr11:121360354..121360373 59.59 55
upstream ENSMUSE00000306493 Chr11:121361350..121361424 GGGGTCTGTGTTGGACTGTT Chr11:121361401..121361420 59.86 55
upstream ENSMUSE00000668563 Chr11:121361350..121361424 GGGGTCTGTGTTGGACTGTT Chr11:121361401..121361420 59.86 55
upstream ENSMUSE00000306486 Chr11:121365007..121365101 ATTGGCAGAGCTGGGTAGAC Chr11:121365049..121365068 59.31 55
upstream ENSMUSE00000668562 Chr11:121365007..121365101 ATTGGCAGAGCTGGGTAGAC Chr11:121365049..121365068 59.31 55

*** Putative Vector Insertion (Chr 11: 121365102 - 121402165) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000306479 Chr11:121402166..121402322 CCCGCTTCTCATCGTAGGTA Chr11:121402213..121402232 60.23 55
downstream ENSMUSE00000668561 Chr11:121402166..121402322 CCCGCTTCTCATCGTAGGTA Chr11:121402213..121402232 60.23 55
downstream ENSMUSE00000306474 Chr11:121411538..121411595 GCAGTTCACATTTCGGTCAA Chr11:121411583..121411602 59.7 45
downstream ENSMUSE00000668560 Chr11:121411538..121411586 GCAGTTCACATTTCGGTCAA Chr11:121411583..121411602 59.7 45
downstream ENSMUSE00000306466 Chr11:121418270..121418299 CTGTCTCCCCACGTTCTCCT Chr11:121418302..121418321 61.63 60
downstream ENSMUSE00000306457 Chr11:121421989..121422074 No primer for this exon
downstream ENSMUSE00000306451 Chr11:121435110..121435190 ATCAATCATGGGCTTGGTGT Chr11:121435158..121435177 60.2 45
downstream ENSMUSE00000306443 Chr11:121436600..121436673 CGGGTACTTGTGGAGTCAGG Chr11:121436658..121436677 60.56 60
downstream ENSMUSE00000306435 Chr11:121437440..121437557 GGCACCATGTCTCGTGTGTA Chr11:121437501..121437520 60.6 55
downstream ENSMUSE00000306430 Chr11:121440029..121440089 GCTTTGCACTGCCTTCTCAT Chr11:121440071..121440090 60.55 50
downstream ENSMUSE00000516024 Chr11:121441462..121441484 TAGAGATGGCGGTCACAAAG Chr11:121441484..121441503 58.87 50
downstream ENSMUSE00000306426 Chr11:121444067..121444098 No primer for this exon
downstream ENSMUSE00000306420 Chr11:121451658..121451720 CCCCTTTAAATGGCATTCTG Chr11:121451711..121451730 59.41 45
downstream ENSMUSE00000367074 Chr11:121452493..121452569 TGTTGTCTGGAATGGCTTGA Chr11:121452565..121452584 60.24 45
downstream ENSMUSE00000306352 Chr11:121453945..121454026 ATTCACTGCAGAGGGCAGTC Chr11:121453987..121454006 60.42 55
downstream ENSMUSE00000306341 Chr11:121455574..121455692 GGAGCTCAGCAAGGTACTGG Chr11:121455609..121455628 60.01 60
downstream ENSMUSE00000306334 Chr11:121457763..121457854 AGCAAAGCTCACATCATTGG Chr11:121457822..121457841 58.88 45
downstream ENSMUSE00000306325 Chr11:121458566..121458706 TGTGTTCACACCAACCGTCT Chr11:121458596..121458615 60.05 50
downstream ENSMUSE00000389127 Chr11:121463271..121463354 CAGCAAAAGCATCAAATCCA Chr11:121463322..121463341 59.81 40
downstream ENSMUSE00000148547 Chr11:121464302..121464460 CGGAACCGATCAATCTTCTC Chr11:121464364..121464383 59.63 50
downstream ENSMUSE00000148551 Chr11:121464548..121464686 GTAGGCAATCCCAAGAGCTG Chr11:121464628..121464647 59.84 55
downstream ENSMUSE00000148556 Chr11:121464929..121465050 CAGGACCTGAGCATCCTTCT Chr11:121464997..121465016 59.4 55
downstream ENSMUSE00000148549 Chr11:121466577..121466654 CAAAGCACCCATTAGCCAAC Chr11:121466635..121466654 60.5 50
downstream ENSMUSE00000148553 Chr11:121469886..121469975 GCTTGACCGAAGTTTCTGGA Chr11:121469970..121469989 60.38 50
downstream ENSMUSE00000148554 Chr11:121470654..121470741 CACCATTGAACTGCACCATC Chr11:121470685..121470704 59.97 50
downstream ENSMUSE00000148548 Chr11:121471295..121471404 ATCAAGCACCTCGGCATCTA Chr11:121471375..121471394 60.76 50
downstream ENSMUSE00000306195 Chr11:121472978..121473062 GCGATTCCGCTGTTCTCTTA Chr11:121473020..121473039 60.49 50
downstream ENSMUSE00000356796 Chr11:121478242..121478477 ACAGCAAACGTATGGGCAGT Chr11:121478445..121478464 60.58 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGGCTTTACTAATCGCCTTG Chr11:121398144..121398164 59.87 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGTTTTGTCAAAGCAGCA Chr11:121398096..121398116 58.55 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039230