Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33085
Trapped Gene
Capn11 (ENSMUSG00000058626)
Vector Insertion
Chr 17: 45771216 - 45775820
Public Clones IST11777A4 (tigm) IST10346D1 (tigm) IST10571F12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 63% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000503137 (Chr17:45775644..45775819 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACGAAATGGTTTGCACCTGT Chr17:45775725..45775744 60.42 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000503137 (Chr17:45775644..45775819 -)
Downstram Exon
ENSMUSE00000695970 (Chr17:45771217..45771228 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACGAAATGGTTTGCACCTGT Chr17:45775725..45775744 60.42 45 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000716634 Chr17:45796194..45796274 TCAAGGACTGTGCTAGGTGCT Chr17:45796248..45796268 60.07 52.38
upstream ENSMUSE00000695973 Chr17:45791053..45791060 No primer for this exon
upstream ENSMUSE00000543002 Chr17:45790455..45790710 GGACCTTCGAGCAGAGTGTC Chr17:45790574..45790593 59.99 60
upstream ENSMUSE00000713465 Chr17:45790455..45790705 GGACCTTCGAGCAGAGTGTC Chr17:45790574..45790593 59.99 60
upstream ENSMUSE00000543001 Chr17:45790132..45790201 CTTCTCTCCCACGGACATCT Chr17:45790147..45790166 59.25 55
upstream ENSMUSE00000607283 Chr17:45780703..45780821 CAAACTGCTGTACCGTGTGG Chr17:45780756..45780775 60.21 55
upstream ENSMUSE00000309861 Chr17:45779778..45779911 CCCACTAGGAACAACAAGCTG Chr17:45779843..45779863 59.78 52.38
upstream ENSMUSE00000309506 Chr17:45779417..45779585 GCAACATGCTAAGGCTCCTC Chr17:45779462..45779481 59.99 55
upstream ENSMUSE00000542999 Chr17:45776752..45776835 GCAGTGACTGGCCTAGAGGA Chr17:45776753..45776772 60.56 60
upstream ENSMUSE00000521395 Chr17:45776572..45776657 AATGGAGCCTGGAGTGACAA Chr17:45776572..45776591 60.66 50
upstream ENSMUSE00000519374 Chr17:45776359..45776433 AAGGATGATGGCGATTTCTG Chr17:45776359..45776378 60.04 45
upstream ENSMUSE00000505156 Chr17:45776018..45776181 GCTGGCACTCCACCTTCTAT Chr17:45776070..45776089 59.31 55
upstream ENSMUSE00000503137 Chr17:45775644..45775819 ACGAAATGGTTTGCACCTGT Chr17:45775725..45775744 60.42 45
upstream ENSMUSE00000695970 Chr17:45771217..45771228 No primer for this exon

*** Putative Vector Insertion (Chr 17: 45771216 - 45775820) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000477593 Chr17:45770721..45770932 TATGGGGCTCATAGGTGGAG Chr17:45770751..45770770 59.91 55
downstream ENSMUSE00000475586 Chr17:45770318..45770357 No primer for this exon
downstream ENSMUSE00000500232 Chr17:45769989..45770054 GCTGAAGAGAATCCTTGTCCA Chr17:45769990..45770010 59.42 47.62
downstream ENSMUSE00000495962 Chr17:45769824..45769881 No primer for this exon
downstream ENSMUSE00000501346 Chr17:45769648..45769712 GCCCTTCGTCTTGAAGTTCC Chr17:45769668..45769687 61.13 55
downstream ENSMUSE00000502382 Chr17:45769330..45769398 CAGCTTGCCAGAACCATCTT Chr17:45769356..45769375 60.4 50
downstream ENSMUSE00000461201 Chr17:45768958..45769036 AGCGGTCCTCATCACACTCT Chr17:45768984..45769003 59.87 55
downstream ENSMUSE00000488865 Chr17:45768737..45768850 GCAACGACTACCTCGGTCAC Chr17:45768789..45768808 60.72 60
downstream ENSMUSE00000542996 Chr17:45767675..45767733 AACCAGTTTTCTTGGTGTCCA Chr17:45767676..45767696 59.48 42.86
downstream ENSMUSE00000657290 Chr17:45767154..45767560 AAATACGGCGTGAGAGTGCT Chr17:45767308..45767327 59.9 50
downstream ENSMUSE00000720579 Chr17:45767153..45767560 AAATACGGCGTGAGAGTGCT Chr17:45767308..45767327 59.9 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACCTTGACCTGGATCTTCC Chr17:45775822..45775842 59.51 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACCTTGACCTGGATCTTCC Chr17:45775822..45775842 59.51 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058626