Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33089
Trapped Gene
Tex16 (ENSMUSG00000034555)
Vector Insertion
Chr X: 109207985 - 109211756
Public Clones IST14290H2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000294183 (ChrX:109207129..109207984 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTTGGTGCTCGTAAAAAGG ChrX:109207950..109207969 59.88 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000294183 (ChrX:109207129..109207984 +)
Downstram Exon
ENSMUSE00000294177 (ChrX:109211757..109211846 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTTGGTGCTCGTAAAAAGG ChrX:109207950..109207969 59.88 50 GCAGGATAATGGGTCTCCAA ChrX:109211783..109211802 59.89 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000294183 ChrX:109207129..109207984 GCTTGGTGCTCGTAAAAAGG ChrX:109207950..109207969 59.88 50

*** Putative Vector Insertion (Chr X: 109207985 - 109211756) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000294177 ChrX:109211757..109211846 GCAGGATAATGGGTCTCCAA ChrX:109211783..109211802 59.89 50
downstream ENSMUSE00000294169 ChrX:109232385..109234825 GCCATCAGGGTCAGATTTGT ChrX:109233433..109233452 59.93 50
downstream ENSMUSE00000294164 ChrX:109240351..109240935 TTTCGAGCTCCACACTCACA ChrX:109240918..109240937 60.59 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCTTGGTGCTCGTAAAAAG ChrX:109207950..109207970 59.88 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTTGGTGCTCGTAAAAAG ChrX:109207950..109207970 59.88 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034555