Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33101
Trapped Gene
Prdm9 (ENSMUSG00000051977)
Vector Insertion
Chr 17: 15682070 - 15690510
Public Clones IST13733F11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 71% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000238524 (Chr17:15690316..15690509 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGAGTACGGCCAGGAACTG Chr17:15690365..15690384 60.13 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000238524 (Chr17:15690316..15690509 -)
Downstram Exon
ENSMUSE00000703518 (Chr17:15682071..15682324 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGAGTACGGCCAGGAACTG Chr17:15690365..15690384 60.13 55 AGAAGGCCAAAGAGCACAAA Chr17:15682255..15682274 59.99 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000238454 Chr17:15701200..15701304 GACCAGCGAGGCTTTCTAGG Chr17:15701208..15701227 61.41 60
upstream ENSMUSE00000238429 Chr17:15700185..15700295 CACCATGAACACCAACAAGC Chr17:15700238..15700257 60.01 50
upstream ENSMUSE00000238405 Chr17:15699778..15699901 AGAAGAATGGGCAGAGATGG Chr17:15699841..15699860 59.24 50
upstream ENSMUSE00000613663 Chr17:15699379..15699486 GAGCCCCTAGACCAGCTTTC Chr17:15699461..15699480 60.35 60
upstream ENSMUSE00000613662 Chr17:15695987..15696036 CCGGGTGAAGCACAGTAAAC Chr17:15695995..15696014 60.55 55
upstream ENSMUSE00000613661 Chr17:15694511..15694538 No primer for this exon
upstream ENSMUSE00000238319 Chr17:15694265..15694421 CAGAACACGTCCAGAAACCA Chr17:15694320..15694339 59.72 50
upstream ENSMUSE00000238308 Chr17:15692530..15692631 ACAGGCTGCGAGAGAGAAAG Chr17:15692579..15692598 59.89 55
upstream ENSMUSE00000238295 Chr17:15692051..15692322 CCCCTATGAGGGTCAGATCA Chr17:15692092..15692111 59.88 55
upstream ENSMUSE00000238540 Chr17:15691652..15691719 TATGTGGATGGACAGGACGA Chr17:15691673..15691692 59.92 50
upstream ENSMUSE00000238524 Chr17:15690316..15690509 ATGAGTACGGCCAGGAACTG Chr17:15690365..15690384 60.13 55
upstream ENSMUSE00000703518 Chr17:15682071..15682324 CCAGGAGATCCCTGTTCAGA Chr17:15682171..15682190 60.19 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGCTGCCTGCCTGATATTT Chr17:15690531..15690551 59.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGAACCTGGTAGCCTTTCG Chr17:15690457..15690477 59.87 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051977