Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33103
Trapped Gene
Mras (ENSMUSG00000032470)
Vector Insertion
Chr 9: 99326195 - 99336975
Public Clones (cmhd) (cmhd) IST11024E2 (tigm) IST12617B11 (tigm) IST11762E7 (tigm)
IST15081G7 (tigm) IST14839F12 (tigm) IST12377A8 (tigm) IST11024E3 (tigm)
IST12873D5 (tigm) IST12416A9 (tigm) IST12000B11 (tigm) IST10212B1 (tigm)
IST14839F12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000693576 (Chr9:99336729..99336974 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGAAGTCGCTCACCACTCC Chr9:99336809..99336828 59.99 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000693576 (Chr9:99336729..99336974 -)
Downstram Exon
ENSMUSE00000721341 (Chr9:99326196..99326315 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGAAGTCGCTCACCACTCC Chr9:99336809..99336828 59.99 60 ATGATCCTAGGGCTGTGGTG Chr9:99326231..99326250 59.95 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000712608 Chr9:99337300..99337300 No primer for this exon
upstream ENSMUSE00000693576 Chr9:99336729..99336974 GAGAAGTCGCTCACCACTCC Chr9:99336809..99336828 59.99 60
upstream ENSMUSE00000721341 Chr9:99326196..99326315 CCAGGCCAGCAGTAAAGAGT Chr9:99326287..99326306 59.5 55

*** Putative Vector Insertion (Chr 9: 99326195 - 99336975) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000228435 Chr9:99311812..99312021 AATGGTGGGGTCGTAGTCAG Chr9:99311845..99311864 59.84 55
downstream ENSMUSE00000718499 Chr9:99311812..99312021 AATGGTGGGGTCGTAGTCAG Chr9:99311845..99311864 59.84 55
downstream ENSMUSE00000500642 Chr9:99294888..99295041 TCCTTGACACGCAGAATGAG Chr9:99294869..99294888 59.98 50
downstream ENSMUSE00000228388 Chr9:99293365..99293464 TTGCCATTTCTTTTCCTTGG Chr9:99293354..99293373 60.05 40
downstream ENSMUSE00000228352 Chr9:99290152..99290231 GGTCCTTGGCACTGGTCTCT Chr9:99290179..99290198 61.65 60
downstream ENSMUSE00000713723 Chr9:99288398..99288923 GTCTGGTGCGTTGTATGTGG Chr9:99288490..99288509 60.03 55
downstream ENSMUSE00000713352 Chr9:99288395..99288923 GTCTGGTGCGTTGTATGTGG Chr9:99288490..99288509 60.03 55
downstream ENSMUSE00000228311 Chr9:99287935..99288923 GTCTGGTGCGTTGTATGTGG Chr9:99288490..99288509 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr9:99333904..99333924 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGACTGGGGGCAGTTACAA Chr9:99333929..99333949 60.38 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032470