Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33110
Trapped Gene
Ntn2l (ENSMUSG00000079662)
Vector Insertion
Chr 17: 24344510 - 24344933
Public Clones IST13135G12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 64% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000138490 (Chr17:24344744..24344932 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGCTTCTATCGTGATCCAG Chr17:24344777..24344796 59.65 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000138490 (Chr17:24344744..24344932 -)
Downstram Exon
ENSMUSE00000520748 (Chr17:24344511..24344660 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGCTTCTATCGTGATCCAG Chr17:24344777..24344796 59.65 55 GGTGAGGCCAGTAACACCAT Chr17:24344547..24344566 59.85 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000138488 Chr17:24345004..24346332 GCCTCGCTCTTGTATTCCTG Chr17:24345805..24345824 59.98 55
upstream ENSMUSE00000138490 Chr17:24344744..24344932 GGGCTTCTATCGTGATCCAG Chr17:24344777..24344796 59.65 55
upstream ENSMUSE00000520748 Chr17:24344511..24344660 ATGGTGTTACTGGCCTCACC Chr17:24344569..24344588 59.85 55

*** Putative Vector Insertion (Chr 17: 24344510 - 24344933) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000138487 Chr17:24344338..24344388 GCTCCACAGGACTGCTTTCT Chr17:24344322..24344341 59.6 55
downstream ENSMUSE00000138492 Chr17:24344153..24344227 CAGGCTGATTCGGTAACTGC Chr17:24344156..24344175 60.8 55
downstream ENSMUSE00000464718 Chr17:24340793..24343892 TTAGGAGCAATGCTGTGTGC Chr17:24340847..24340866 60.02 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000079662