Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33119
Trapped Gene
Stk35 (ENSMUSG00000037885)
Vector Insertion
Chr 2: 129626583 - 129627139
Public Clones IST14560B6 (tigm) IST14023D11 (tigm) IST14926B6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000706273 (Chr2:129626488..129626582 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000706273 (Chr2:129626488..129626582 +)
Downstram Exon
ENSMUSE00000262411 (Chr2:129627140..129627740 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GCTAGTGCCAACTCCACGTT Chr2:129627588..129627607 60.32 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000641175 Chr2:129626297..129626582 TTGCTGTCATCACAAGAGCAG Chr2:129626416..129626436 60.19 47.62
upstream ENSMUSE00000706273 Chr2:129626488..129626582 No primer for this exon

*** Putative Vector Insertion (Chr 2: 129626583 - 129627139) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000262411 Chr2:129627140..129627740 GCTAGTGCCAACTCCACGTT Chr2:129627588..129627607 60.32 55
downstream ENSMUSE00000507804 Chr2:129636224..129636973 TCCATTCGGGTTTCAAGTTC Chr2:129636917..129636936 59.91 45
downstream ENSMUSE00000262394 Chr2:129653510..129653723 CTGTCCGAGACACGATGAGA Chr2:129653554..129653573 59.98 55
downstream ENSMUSE00000641173 Chr2:129653510..129658023 AGCTGCTACATGGGCCTCTA Chr2:129654734..129654753 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr2:129626634..129626654 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAGGGAGTGGAGGGAGGAA Chr2:129626587..129626607 62.45 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037885