Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33120
Trapped Gene
Stk39 (ENSMUSG00000027030)
Vector Insertion
Chr 2: 68105095 - 68145166
Public Clones IST12537H12 (tigm) IST11049G8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000242371 (Chr2:68145098..68145165 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTCCTTGTGCAGTCAACCT Chr2:68145113..68145132 60.16 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000242371 (Chr2:68145098..68145165 -)
Downstram Exon
ENSMUSE00000662382 (Chr2:68105096..68105148 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTCCTTGTGCAGTCAACCT Chr2:68145113..68145132 60.16 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662384 Chr2:68309691..68310325 CGAGGCTAGGGAAGTTTCAA Chr2:68309988..68310007 59.45 50
upstream ENSMUSE00000662383 Chr2:68248086..68248198 TGCCAGACGAGTATGGATGA Chr2:68248093..68248112 60.22 50
upstream ENSMUSE00000566667 Chr2:68236481..68236589 AAGATGAGCTGTGGCTGGTC Chr2:68236500..68236519 60.42 55
upstream ENSMUSE00000165529 Chr2:68230168..68230309 CACAGAAACGGTCAGATCCA Chr2:68230171..68230190 59.68 50
upstream ENSMUSE00000165528 Chr2:68228971..68229026 ATTCTTCTGGGTGAGGATGG Chr2:68228988..68229007 58.94 50
upstream ENSMUSE00000165517 Chr2:68207053..68207162 TAAGCGCATTCTTAGCCACA Chr2:68207134..68207153 59.61 45
upstream ENSMUSE00000482991 Chr2:68206454..68206555 AGCGCCTTACCACAAATACC Chr2:68206465..68206484 59.11 50
upstream ENSMUSE00000566666 Chr2:68204131..68204264 GACCCGCCCACTTTAGAAAC Chr2:68204221..68204240 60.86 55
upstream ENSMUSE00000566665 Chr2:68197043..68197091 CCCACAGCAGCAGAACTTTT Chr2:68197071..68197090 60.43 50
upstream ENSMUSE00000242397 Chr2:68196871..68196936 CCAGACATAGCCCAAAGAGC Chr2:68196878..68196897 59.84 55
upstream ENSMUSE00000242392 Chr2:68152538..68152660 ATGGATGAGAAGAGCGAGGA Chr2:68152566..68152585 59.91 50
upstream ENSMUSE00000242384 Chr2:68152421..68152450 No primer for this exon
upstream ENSMUSE00000242376 Chr2:68147049..68147111 GTGGCATCCCTGAGCAAATA Chr2:68147076..68147095 61 50
upstream ENSMUSE00000242371 Chr2:68145098..68145165 GGTCCTTGTGCAGTCAACCT Chr2:68145113..68145132 60.16 55
upstream ENSMUSE00000662382 Chr2:68105096..68105148 No primer for this exon

*** Putative Vector Insertion (Chr 2: 68105095 - 68145166) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000662381 Chr2:68101292..68101360 TGAGACACACCGTCTGCTGT Chr2:68101317..68101336 60.53 55
downstream ENSMUSE00000485016 Chr2:68058961..68059025 AAAGCTTTGGGGTCATCTACAA Chr2:68058961..68058982 60 40.91
downstream ENSMUSE00000515077 Chr2:68048503..68050050 CTCTCCCAAGAGACGACTGG Chr2:68049183..68049202 59.98 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCAAGCATCTGGGTCTTAT Chr2:68145140..68145160 59.15 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCCTGGAGGATCGTGACTG Chr2:68136107..68136127 60.07 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027030