Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33124
Trapped Gene
Eepd1 (ENSMUSG00000036611)
Vector Insertion
Chr 9: 25402341 - 25410993
Public Clones IST15068C3 (tigm) IST10872E11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000268052 (Chr9:25402146..25402340 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TAGTCCCGGCTCACACTTTC Chr9:25402236..25402255 60.26 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000268052 (Chr9:25402146..25402340 +)
Downstram Exon
ENSMUSE00000331342 (Chr9:25410994..25411694 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TAGTCCCGGCTCACACTTTC Chr9:25402236..25402255 60.26 55 CCCTGTAGTGCCATCTCCAT Chr9:25411257..25411276 59.95 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000413905 Chr9:25289182..25289481 CTGGATTCAAGCAGCTACGA Chr9:25289287..25289306 59.17 50
upstream ENSMUSE00000410963 Chr9:25289866..25290904 GAATATATCGGCGGCTTCAA Chr9:25290231..25290250 60.03 45
upstream ENSMUSE00000268158 Chr9:25355137..25355188 ACAAAGAGGCCCTGGAAAAG Chr9:25355169..25355188 60.6 50
upstream ENSMUSE00000268127 Chr9:25389477..25389587 GATGCTGGAGGTCCATTGTT Chr9:25389538..25389557 59.93 50
upstream ENSMUSE00000268098 Chr9:25394247..25394381 CTTTCCTCGCCAGATTCAAG Chr9:25394362..25394381 59.95 50
upstream ENSMUSE00000268075 Chr9:25397020..25397158 TGGCCACCGATTATTGAACT Chr9:25397109..25397128 60.33 45
upstream ENSMUSE00000268052 Chr9:25402146..25402340 TAGTCCCGGCTCACACTTTC Chr9:25402236..25402255 60.26 55

*** Putative Vector Insertion (Chr 9: 25402341 - 25410993) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000331342 Chr9:25410994..25411694 CCCTGTAGTGCCATCTCCAT Chr9:25411257..25411276 59.95 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCCCTGCTGTCTCTGTTC Chr9:25408353..25408373 59.99 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCCCTGCTGTCTCTGTTC Chr9:25408353..25408373 59.99 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036611