Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33141
Trapped Gene
Slco4a1 (ENSMUSG00000038963)
Vector Insertion
Chr 2: 180191079 - 180195683
Public Clones IST10920F10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000454115 (Chr2:180191039..180191078 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000454115 (Chr2:180191039..180191078 +)
Downstram Exon
ENSMUSE00000410199 (Chr2:180195684..180195903 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TTTTCTCAGTCCGAGCAGGT Chr2:180195785..180195804 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000454115 Chr2:180191039..180191078 No primer for this exon

*** Putative Vector Insertion (Chr 2: 180191079 - 180195683) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000410199 Chr2:180195684..180195903 TTTTCTCAGTCCGAGCAGGT Chr2:180195785..180195804 59.99 50
downstream ENSMUSE00000369718 Chr2:180198646..180199533 CCCAAAGTAGCTGACGAAGG Chr2:180199223..180199242 59.87 55
downstream ENSMUSE00000707989 Chr2:180198646..180199533 CCCAAAGTAGCTGACGAAGG Chr2:180199223..180199242 59.87 55
downstream ENSMUSE00000224897 Chr2:180200302..180200392 TGGCTCCTCCAATCAGGTAG Chr2:180200364..180200383 60.21 55
downstream ENSMUSE00000224892 Chr2:180201763..180201884 No primer for this exon
downstream ENSMUSE00000224927 Chr2:180202272..180202383 AAGCTGGATTGCTCACTGCT Chr2:180202358..180202377 60.16 50
downstream ENSMUSE00000224919 Chr2:180205809..180205963 AGAACTTGGGACCGAATGTG Chr2:180205918..180205937 59.97 50
downstream ENSMUSE00000224914 Chr2:180206759..180206954 GAACCTGATGATCCCAGAGC Chr2:180206856..180206875 59.62 55
downstream ENSMUSE00000224910 Chr2:180207110..180207275 TGCCTTTAGGTCCAGCTGTC Chr2:180207146..180207165 60.4 55
downstream ENSMUSE00000224880 Chr2:180207366..180207538 CAACGAACACGAGAACCAGA Chr2:180207489..180207508 59.87 50
downstream ENSMUSE00000224873 Chr2:180207808..180207872 AGGATCTTTGCCGATCACTG Chr2:180207836..180207855 60.22 50
downstream ENSMUSE00000395719 Chr2:180208219..180208367 GGCTCATGGCTTCATTCTCA Chr2:180208338..180208357 61.3 50
downstream ENSMUSE00000381525 Chr2:180208809..180209555 GACACGGAAGGGGACTTGTA Chr2:180208870..180208889 59.97 55
downstream ENSMUSE00000638607 Chr2:180208809..180209572 GACACGGAAGGGGACTTGTA Chr2:180208870..180208889 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGAGCTGCCTCCTCCTGAA Chr2:180191039..180191059 60.23 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAGAGCTGCCTCCTCCTGAA Chr2:180191039..180191059 60.23 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038963