Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33147
Trapped Gene
Capn1 (ENSMUSG00000024942)
Vector Insertion
Chr 19: 6009086 - 6011184
Public Clones IST14814D6 (tigm) IST14814D6 (tigm) IST13698E5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000228797 (Chr19:6011015..6011183 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAGCTATGAGGCTCTTTCG Chr19:6011156..6011175 60.26 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000228797 (Chr19:6011015..6011183 -)
Downstram Exon
ENSMUSE00000228772 (Chr19:6009087..6009170 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAGCTATGAGGCTCTTTCG Chr19:6011156..6011175 60.26 55 CCCCTCACCAGGTTCTTAAA Chr19:6009096..6009115 59.02 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000622364 Chr19:6015106..6015182 AATCTCCCAAACTCCCCTTC Chr19:6015111..6015130 59.37 50
upstream ENSMUSE00000393895 Chr19:6014201..6014468 TCAAGGAACTGGGTCCTCAT Chr19:6014240..6014259 59.51 50
upstream ENSMUSE00000228855 Chr19:6013996..6014065 CTGATGTCAAACCCCCAGTT Chr19:6014043..6014062 59.82 50
upstream ENSMUSE00000551927 Chr19:6013589..6013707 GCTACGCTGGCATCTTTCAT Chr19:6013595..6013614 60.38 50
upstream ENSMUSE00000228816 Chr19:6011297..6011430 GGGTCGACGTGGTCATAGAT Chr19:6011392..6011411 59.81 55
upstream ENSMUSE00000228797 Chr19:6011015..6011183 GCAGCTATGAGGCTCTTTCG Chr19:6011156..6011175 60.26 55
upstream ENSMUSE00000228772 Chr19:6009087..6009170 GGCCATGCGTACTCTGTGAC Chr19:6009100..6009119 61.7 60

*** Putative Vector Insertion (Chr 19: 6009086 - 6011184) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000228754 Chr19:6008676..6008761 TGTCACTCCAGGGTCCTTTC Chr19:6008655..6008674 60.09 55
downstream ENSMUSE00000228730 Chr19:6007500..6007574 CTCTCGTTCATAGGGGTCCA Chr19:6007513..6007532 60.06 55
downstream ENSMUSE00000146494 Chr19:6007252..6007412 GTGCCCTCGTAAAATGTGGT Chr19:6007274..6007293 59.86 50
downstream ENSMUSE00000551890 Chr19:5997691..5997866 CGACTCCCGGTTGTCATAGT Chr19:5997765..5997784 59.99 55
downstream ENSMUSE00000696152 Chr19:5996779..5996790 No primer for this exon
downstream ENSMUSE00000551809 Chr19:5994679..5994887 GACTTCCCGAAGGTTGATGA Chr19:5994773..5994792 60.05 50
downstream ENSMUSE00000146491 Chr19:5994560..5994599 GGCCTGGATCTGGTCATCTA Chr19:5994553..5994572 60.03 55
downstream ENSMUSE00000146489 Chr19:5994021..5994086 CCAACTTGCTGAACAAGGTCT Chr19:5994007..5994027 59.39 47.62
downstream ENSMUSE00000146493 Chr19:5993874..5993931 AGCTCCTTGACGCTGATCTC Chr19:5993884..5993903 59.71 55
downstream ENSMUSE00000146497 Chr19:5992350..5992414 CCATTAGTGCGCAGGTCTTT Chr19:5992371..5992390 60.27 50
downstream ENSMUSE00000146492 Chr19:5991856..5991924 GGATGTTGAACTCCACCAGA Chr19:5991860..5991879 58.48 50
downstream ENSMUSE00000146495 Chr19:5991539..5991617 GCCATCCTCATCTCATAGGC Chr19:5991531..5991550 59.62 55
downstream ENSMUSE00000146488 Chr19:5990338..5990454 CTCCGAGTAGCGGGTGATTA Chr19:5990380..5990399 60.23 55
downstream ENSMUSE00000146487 Chr19:5989992..5990050 CAACACCATCCAGGTCTGTG Chr19:5989990..5990009 60 55
downstream ENSMUSE00000412031 Chr19:5988546..5989387 ACCCCCAGTTCCTCCATAAC Chr19:5988578..5988597 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGCAGCTATGAGGCTCTTT Chr19:6011156..6011176 60.12 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGCAGCTATGAGGCTCTTT Chr19:6011156..6011176 60.12 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024942