Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33149
Trapped Gene
Slamf6 (ENSMUSG00000015314)
Vector Insertion
Chr 1: 173872724 - 173878129
Public Clones IST11779B7 (tigm) IST12308F5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 93% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000161405 (Chr1:173872709..173872723 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000161405 (Chr1:173872709..173872723 +)
Downstram Exon
ENSMUSE00000297438 (Chr1:173878130..173878206 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000392491 Chr1:173847646..173847923 No primer for this exon
upstream ENSMUSE00000161411 Chr1:173864230..173864571 No primer for this exon
upstream ENSMUSE00000161413 Chr1:173866600..173866863 No primer for this exon
upstream ENSMUSE00000297477 Chr1:173868133..173868246 No primer for this exon
upstream ENSMUSE00000161407 Chr1:173868583..173868612 No primer for this exon
upstream ENSMUSE00000161410 Chr1:173869527..173869600 No primer for this exon
upstream ENSMUSE00000488194 Chr1:173871756..173871827 No primer for this exon
upstream ENSMUSE00000161405 Chr1:173872709..173872723 No primer for this exon

*** Putative Vector Insertion (Chr 1: 173872724 - 173878129) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000297438 Chr1:173878130..173878206 No primer for this exon
downstream ENSMUSE00000297430 Chr1:173878824..173879083 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAAGACATCAAATTGGCGAAA Chr1:173875723..173875744 59.58 33.33 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGGAGAACACATCTCGTG Chr1:173875759..173875779 59.26 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015314