Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33150
Trapped Gene
Mcam (ENSMUSG00000032135)
Vector Insertion
Chr 9: 43948777 - 43948927
Public Clones IST10825H6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 91% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000216919 (Chr9:43948681..43948776 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TACCTGACTCCAGCCAAACC Chr9:43948699..43948718 60.11 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000216919 (Chr9:43948681..43948776 +)
Downstram Exon
ENSMUSE00000508859 (Chr9:43948928..43949075 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TACCTGACTCCAGCCAAACC Chr9:43948699..43948718 60.11 55 GCAGCTTGCCCTTCTTGTAG Chr9:43949050..43949069 60.15 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000361170 Chr9:43942754..43942839 TGGTGTGCGTCTTCTTGTTC Chr9:43942789..43942808 59.88 50
upstream ENSMUSE00000216926 Chr9:43944601..43944731 ACAGCCCTTCTCAAGTGTGG Chr9:43944666..43944685 60.3 55
upstream ENSMUSE00000354583 Chr9:43944821..43945028 CCAAGACTCGGTGGCTACTC Chr9:43944910..43944929 59.87 60
upstream ENSMUSE00000426016 Chr9:43945122..43945192 GCCCCAGAGGAACCAACTAT Chr9:43945124..43945143 60.33 55
upstream ENSMUSE00000216928 Chr9:43945301..43945388 GGCTACCCCATTCCTCAAGT Chr9:43945325..43945344 60.33 55
upstream ENSMUSE00000216912 Chr9:43946918..43947097 AGTGGGAACCACATGAAGGA Chr9:43947049..43947068 60.36 50
upstream ENSMUSE00000216905 Chr9:43947241..43947362 GGAAGGGGATCATGTGACAA Chr9:43947290..43947309 60.72 50
upstream ENSMUSE00000216908 Chr9:43947483..43947645 AAGAGGAGAGCACCGATGAA Chr9:43947505..43947524 59.95 50
upstream ENSMUSE00000216920 Chr9:43947736..43947854 CTGCGAGGCAGAAAGTAACC Chr9:43947803..43947822 60.01 55
upstream ENSMUSE00000216899 Chr9:43947943..43948084 TTCCTGGCTTGAATCGTACC Chr9:43948040..43948059 60.07 50
upstream ENSMUSE00000216897 Chr9:43948220..43948341 AGGTGTGGGTGCAAGAGAAT Chr9:43948250..43948269 59.58 50
upstream ENSMUSE00000216922 Chr9:43948445..43948586 ATGGAACCCAGATCCACAGA Chr9:43948453..43948472 60.33 50
upstream ENSMUSE00000216919 Chr9:43948681..43948776 TACCTGACTCCAGCCAAACC Chr9:43948699..43948718 60.11 55

*** Putative Vector Insertion (Chr 9: 43948777 - 43948927) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000508859 Chr9:43948928..43949075 GCAGCTTGCCCTTCTTGTAG Chr9:43949050..43949069 60.15 55
downstream ENSMUSE00000536032 Chr9:43949358..43949475 GTCTCCTGGAGCCCTCTTGT Chr9:43949475..43949494 60.79 60
downstream ENSMUSE00000536031 Chr9:43949867..43950803 CACAAGGACCAATGTGAACG Chr9:43950296..43950315 60 50
downstream ENSMUSE00000637506 Chr9:43949867..43950803 CACAAGGACCAATGTGAACG Chr9:43950296..43950315 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATAATCGCCTTGCAGCAC Chr9:43948825..43948845 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCACCCTCACAGTCAGTCCT Chr9:43948730..43948750 60.31 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032135