Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33163
Trapped Gene
Dbr1 (ENSMUSG00000032469)
Vector Insertion
Chr 9: 99476545 - 99476994
Public Clones IST10090E9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000398835 (Chr9:99476225..99476544 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAAGTACCGTCACATGCAG Chr9:99476514..99476533 60.17 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000398835 (Chr9:99476225..99476544 +)
Downstram Exon
ENSMUSE00000219906 (Chr9:99476995..99477119 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAAGTACCGTCACATGCAG Chr9:99476514..99476533 60.17 55 AATGGTTTGAGGCTTCATGG Chr9:99477071..99477090 59.93 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000398835 Chr9:99476225..99476544 CCAAGTACCGTCACATGCAG Chr9:99476514..99476533 60.17 55

*** Putative Vector Insertion (Chr 9: 99476545 - 99476994) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000219906 Chr9:99476995..99477119 AATGGTTTGAGGCTTCATGG Chr9:99477071..99477090 59.93 45
downstream ENSMUSE00000219902 Chr9:99478860..99478940 CAGAGATGCCACCAATCCTTA Chr9:99478912..99478932 60.08 47.62
downstream ENSMUSE00000325617 Chr9:99479776..99479861 No primer for this exon
downstream ENSMUSE00000219905 Chr9:99480558..99480782 AGAACCAGTACGCAGGCTGT Chr9:99480741..99480760 59.94 55
downstream ENSMUSE00000219899 Chr9:99482441..99482521 AAGTCTCTGTGTGGCAAGCA Chr9:99482517..99482536 59.62 50
downstream ENSMUSE00000219901 Chr9:99482736..99482881 CTTGTGTGCAGACCGTTGTC Chr9:99482884..99482903 60.36 55
downstream ENSMUSE00000451723 Chr9:99483731..99484873 AGACTCCACCGTTTCACCAC Chr9:99484307..99484326 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGTACCGTCACATGCAGACC Chr9:99476517..99476538 60.05 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGTACCGTCACATGCAGACC Chr9:99476517..99476538 60.05 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032469