Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33165
Trapped Gene
2810030E01Rik (ENSMUSG00000054074)
Vector Insertion
Chr 2: 17967236 - 17969967
Public Clones IST13060C8 (tigm) IST11080H5 (tigm) IST11335G8 (tigm) IST13044A10 (tigm)
IST14732F4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 27% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000569880 (Chr2:17969298..17969966 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTATTTTCGGAGCCTGCTG Chr2:17969313..17969332 59.97 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000569880 (Chr2:17969298..17969966 -)
Downstram Exon
ENSMUSE00000429402 (Chr2:17967237..17969036 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTATTTTCGGAGCCTGCTG Chr2:17969313..17969332 59.97 50 CTCCTCCGAGCTGATTTCAC Chr2:17968628..17968647 59.95 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000700266 Chr2:17970670..17970678 No primer for this exon
upstream ENSMUSE00000569880 Chr2:17969298..17969966 CTTATTTTCGGAGCCTGCTG Chr2:17969313..17969332 59.97 50
upstream ENSMUSE00000429410 Chr2:17969296..17970076 CTTATTTTCGGAGCCTGCTG Chr2:17969313..17969332 59.97 50
upstream ENSMUSE00000429402 Chr2:17967237..17969036 GTGAAATCAGCTCGGAGGAG Chr2:17968650..17968669 59.95 55

*** Putative Vector Insertion (Chr 2: 17967236 - 17969967) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000569881 Chr2:17965710..17969034 CTCCTCCGAGCTGATTTCAC Chr2:17968628..17968647 59.95 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000054074