Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33171
Trapped Gene
Art5 (ENSMUSG00000070424)
Vector Insertion
Chr 7: 109248344 - 109251360
Public Clones IST14387D9 (tigm) IST13504A7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000589870 (Chr7:109251268..109251359 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000589870 (Chr7:109251268..109251359 -)
Downstram Exon
ENSMUSE00000671614 (Chr7:109248345..109248787 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CAGATCGCAGATCCTGAACA Chr7:109248409..109248428 59.94 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000589870 Chr7:109251268..109251359 No primer for this exon
upstream ENSMUSE00000589869 Chr7:109248345..109248455 GTCAGCCGCAAAGAACCATA Chr7:109248384..109248403 61.17 50
upstream ENSMUSE00000671605 Chr7:109248345..109248453 GTCAGCCGCAAAGAACCATA Chr7:109248384..109248403 61.17 50
upstream ENSMUSE00000671614 Chr7:109248345..109248787 AGAGTTTTGCCCCTCAATCA Chr7:109248564..109248583 59.67 45
upstream ENSMUSE00000671621 Chr7:109248345..109248743 AGAGTTTTGCCCCTCAATCA Chr7:109248564..109248583 59.67 45

*** Putative Vector Insertion (Chr 7: 109248344 - 109251360) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000589868 Chr7:109247948..109248157 TTCAGCCTAGGAGGGTCCTT Chr7:109248078..109248097 60.2 55
downstream ENSMUSE00000633200 Chr7:109247948..109248007 ACCATCAGCAGATCCTCCAG Chr7:109247960..109247979 60.22 55
downstream ENSMUSE00000671604 Chr7:109247948..109248105 ACCATCAGCAGATCCTCCAG Chr7:109247960..109247979 60.22 55
downstream ENSMUSE00000671613 Chr7:109247948..109248158 TTCAGCCTAGGAGGGTCCTT Chr7:109248078..109248097 60.2 55
downstream ENSMUSE00000709380 Chr7:109247948..109248157 TTCAGCCTAGGAGGGTCCTT Chr7:109248078..109248097 60.2 55
downstream ENSMUSE00000671618 Chr7:109246743..109247024 CCCACATAGGCATCATCAAA Chr7:109246938..109246957 59.35 45
downstream ENSMUSE00000671608 Chr7:109246730..109247024 CCCACATAGGCATCATCAAA Chr7:109246938..109246957 59.35 45
downstream ENSMUSE00000626126 Chr7:109246298..109247024 GAAGACTTCGTGTGGGGGTA Chr7:109246370..109246389 59.97 55
downstream ENSMUSE00000589867 Chr7:109246295..109247024 GAAGACTTCGTGTGGGGGTA Chr7:109246370..109246389 59.97 55
downstream ENSMUSE00000671617 Chr7:109246295..109246448 GAAGACTTCGTGTGGGGGTA Chr7:109246370..109246389 59.97 55
downstream ENSMUSE00000633199 Chr7:109245993..109246001 No primer for this exon
downstream ENSMUSE00000528607 Chr7:109245822..109245849 No primer for this exon
downstream ENSMUSE00000589866 Chr7:109245822..109245854 CACACAGCCACGTCTCTTCT Chr7:109245810..109245829 59.05 55
downstream ENSMUSE00000633198 Chr7:109245713..109245731 No primer for this exon
downstream ENSMUSE00000671607 Chr7:109245628..109245734 CTTGGGTCCAAGAGCAGTGT Chr7:109245637..109245656 60.3 55
downstream ENSMUSE00000633197 Chr7:109245573..109245710 CTTGGGTCCAAGAGCAGTGT Chr7:109245637..109245656 60.3 55
downstream ENSMUSE00000671610 Chr7:109245395..109245734 CCAACTCTGGTTGGACAGGT Chr7:109245483..109245502 60 55
downstream ENSMUSE00000671615 Chr7:109245394..109245734 CCAACTCTGGTTGGACAGGT Chr7:109245483..109245502 60 55
downstream ENSMUSE00000589865 Chr7:109245393..109245734 CCAACTCTGGTTGGACAGGT Chr7:109245483..109245502 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCAGCCGCAAAGAACCATA Chr7:109251382..109251402 61.17 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCAGCCGCAAAGAACCATA Chr7:109251382..109251402 61.17 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000070424